WO2019235895A1 - Transgenic mouse for aglycosylated antibody production and use of aglycosylated antibody produced therefrom - Google Patents

Transgenic mouse for aglycosylated antibody production and use of aglycosylated antibody produced therefrom Download PDF

Info

Publication number
WO2019235895A1
WO2019235895A1 PCT/KR2019/006912 KR2019006912W WO2019235895A1 WO 2019235895 A1 WO2019235895 A1 WO 2019235895A1 KR 2019006912 W KR2019006912 W KR 2019006912W WO 2019235895 A1 WO2019235895 A1 WO 2019235895A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
amino acid
antibody
substituted
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2019/006912
Other languages
French (fr)
Korean (ko)
Inventor
김용삼
고정헌
이난이
김선희
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority to EP19814996.5A priority Critical patent/EP3804512A4/en
Priority to US16/972,803 priority patent/US12048296B2/en
Priority to AU2019283621A priority patent/AU2019283621B2/en
Priority to CN201980050543.5A priority patent/CN112512310B/en
Priority to JP2020568257A priority patent/JP7268059B2/en
Publication of WO2019235895A1 publication Critical patent/WO2019235895A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276Knock-out vertebrates
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/01Animal expressing industrially exogenous proteins
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/10Immunoglobulins specific features characterized by their source of isolation or production
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/40Immunoglobulins specific features characterized by post-translational modification
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/40Immunoglobulins specific features characterized by post-translational modification
    • C07K2317/41Glycosylation, sialylation, or fucosylation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • C07K2317/524CH2 domain
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/319Chemical structure of the backbone linked by 2'-5' linkages, i.e. having a free 3'-position
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/80Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • the present invention relates to a method for diagnosing a disease by analyzing a glycoprotein biomarker with a transformed mouse for producing a glycoside antibody, a glycoside antibody against a target antigen produced therefrom, and a produced glycoside antibody.
  • the present invention was made with the support of the Korean government according to task number 1711064732, "Development of a sugarless antibody production system through gene editing," of the Ministry of Science and Technology.
  • Glycoproteins are used as markers for diagnosing diseases.
  • PSA prostate-specific antigen
  • CEA carcinoembryogenic antigen
  • AFP alpha-fetoprotein
  • Immunoglobulins are widely used tools in the field of disease diagnosis, and IgG type antibodies dominate the diagnostic market.
  • IgG consists of two heavy chains and two light chains linked by disulfide bonds. IgG undergoes sugar chain modification at the Asn297 site in the CH2 constant domain of the heavy chain (N-glycosylation). N-glycosylation occurs in a consensus sequence called Asn-X (ex. Pro) -Ser / Thr.
  • Asn-X ex. Pro
  • lectins are used to identify sugar chains such as glycoproteins, but they may cross-link to sugar chains of IgG to confuse analysis results.
  • One object of the invention is a nucleotide sequence encoding one or more gRNAs (guide RNAs) that hybridize to DNA encoding an IgG (immunoglobulin G) gene; Nucleotide sequences encoding Cas9 proteins; Nucleotide sequences encoding adenine base editors (ABEs); And it provides a recombinant expression vector or RNA produced from the recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.
  • gRNAs guide RNAs
  • Another object of the present invention is to provide a method for producing an animal model for the production of a sugar-free antibody comprising the step of transplanting the fertilized egg into the fallopian tube of the surrogate mother, except for human.
  • Still another object of the present invention is to provide an animal model for the production of a saccharide-free antibody in which an IgG (immunoglobulin G) gene is modified.
  • IgG immunoglobulin G
  • Still another object of the present invention is to provide a method for producing a glycosyl antibody against an antigen comprising administering an antigen to be diagnosed to the animal model.
  • Still another object of the present invention is to provide a sugar free antibody produced by the method for producing a sugar free antibody.
  • Another object of the present invention is a sugar-free antibody; And it provides an immunodiagnostic kit comprising a glycoprotein biomarker.
  • One aspect of the invention is a nucleotide sequence encoding one or more gRNA (guide RNA) that hybridizes to DNA encoding an IgG (immunoglobulin G) gene; Nucleotide sequences encoding Cas9 proteins; Nucleotide sequences encoding adenine base editors (ABEs); And it provides a recombinant expression vector or RNA produced from the recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.
  • gRNA guide RNA
  • the IgG may be one or more IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.
  • the gRNA may comprise a nucleotide sequence complementary to any one sequence selected from the group consisting of SEQ ID NOs: 2 to 5.
  • Another aspect of the present invention provides a transformed cell line or fertilized egg for the production of an animal model for the production of aglycosylated antibody into which the recombinant expression vector or RNA is introduced.
  • Another aspect of the present invention provides a method for producing an animal model for the production of a saccharide-free antibody comprising the step of implanting the fertilized egg into the fallopian tube of the surrogate mother, except for humans.
  • the animal may be a rabbit, goat or mouse.
  • the production of the sugar-free antibody may be by modification of one or more IgG selected from the group consisting of IgG1, IgG2a IgG2b, IgG2c and IgG3.
  • the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40;
  • the sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37;
  • the sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38;
  • the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.
  • Another aspect of the present invention provides an animal model for the production of a glycosylated antibody in which an IgG (immunoglobulin G) gene is modified.
  • IgG immunoglobulin G
  • the modification is amino acid N of the N-S-T sequence in the amino acid sequence of the IgG1 heavy chain substitution of another amino acid; Amino acid N in the amino acid sequence of the IgG2a heavy chain is substituted with another amino acid in the N-S-T sequence; Amino acid N in the amino acid sequence of the IgG2b heavy chain is substituted with another amino acid in the N-S-T sequence; Amino acid N in the amino acid sequence of the IgG2c heavy chain is substituted with another amino acid in the N-S-T sequence; And amino acid N in the N-S-T sequence in the amino acid sequence of the IgG3 heavy chain may be generated by one or more substitutions selected from the group consisting of substitution with other amino acids.
  • the N-S-T sequence may be amino acid sequence 297 to 299 of any one of the IgG heavy chain selected from the group consisting of IgG1, IgG2a IgG2b, IgG2c and IgG3.
  • the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40;
  • the sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37;
  • the sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38;
  • the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.
  • the animal may be any animal capable of producing antibodies as well as rabbits, goats or mice.
  • Another aspect of the present invention provides a method for producing a glycosyl antibody against an antigen comprising administering an antigen to be diagnosed to the animal model.
  • Another aspect of the present invention provides a sugar free antibody produced by the method for producing a sugar free antibody.
  • Another aspect of the present invention is a sugar-free antibody; And it provides an immunodiagnostic kit comprising a glycoprotein biomarker.
  • the glycoprotein biomarker can be detected by lectin.
  • the lectin is L4-PHA (Phytohemagglutinin-L4), LCA (lens culinaris agglutinin), DSA (Datura stramonium agglutinin), AAL (Aleuria aurantia agglutinin), Selectin (Selectin), Con A ( Concanavalin-A), Heat germ agglutinin (WGA), Jacalin (Jacalin), Sambucus Nigra agglutinin (SNA) or galectin.
  • L4-PHA Physicalhemagglutinin-L4
  • LCA lacs culinaris agglutinin
  • DSA Natural stramonium agglutinin
  • AAL Aleuria aurantia agglutinin
  • Selectin Selectin
  • Con A Concanavalin-A
  • WGA Heat germ agglutinin
  • WGA Jacalin
  • Jacalin Jacalin
  • SNA Sambu
  • the glycoprotein may be AFP-L3.
  • transgenic mouse of the present invention it is possible to easily produce a glycosylated antibody against various target antigens, and precisely detect the glycoprotein biomarker with the produced glycosylated antibody to precisely diagnose the disease.
  • FIG. 1 is a schematic diagram showing that lectins can bind to capture antibodies even when no analyte is present.
  • Figure 2 is a schematic diagram showing a specific glycoform (glycoform) analysis method through the lysine and saccharide-free antibody ALIQUAT (Aglycosylated antibody-Lectin coupled Immunoassay for the QUAntification of Tumor marker).
  • ALIQUAT Aglycosylated antibody-Lectin coupled Immunoassay for the QUAntification of Tumor marker.
  • FIG. 3 is a diagram showing an N-S-T sequence commonly present in IgG2c, IgG2b, IgG1 and IgG3.
  • Figure 4 is a schematic diagram showing the screening process of the edited mutations using amplification refractory mutation system (ARMS) and PCR.
  • ARMS amplification refractory mutation system
  • FIG. 6 is a diagram showing Sanger sequence analysis results for IgG2b genes of nine pups born after adenine nucleotide editing.
  • FIG. 7 is a diagram showing Sanger sequence analysis results for the IgG3 gene of nine pups born after the adenine base editing process.
  • FIG. 8 is a diagram showing the nucleotide sequence of the IgG2c edited according to the adenine base edit.
  • FIG. 9 is a diagram showing the nucleotide sequence of the IgG2b edited according to the adenine base edit.
  • FIG. 10 is a diagram showing the nucleotide sequence of the IgG3 edited according to the adenine base edit.
  • FIG. 11 is a diagram showing the result of Sanger sequence analysis of pup (# 11) in IgG2c and IgG3.
  • FIG. 12 is a diagram showing a structure analysis result of IgG for selecting an intermediate founder.
  • Wild type IgG protein structure shows the conserved motif of N-glycosylated N-S-T at Asn residues.
  • Figure 13 shows the nucleotide sequence of the IgG1 edited according to the adenine base edit.
  • FIG. 15 is a diagram showing a defect of a gene of a corresponding subclass in a mouse knocked out of an IgG2b gene.
  • Figure 16 is a diagram showing the defect of the gene of the corresponding subclass in the mouse knocked out IgG3 gene.
  • FIG. 17 shows that human AFP, a cancer marker of hepatocellular carcinoma, was administered to the animal-free antibody-producing animal as a model antigen, and serum was collected at each immunization step to perform direct ELISA analysis on hAFP. It is a graph showing increased reactivity over time.
  • FIG. 18 is a diagram showing hybridoma clones producing antibodies specifically specific for hAFP.
  • Figure 19 is a diagram showing the monoclonal antibody secretion of IgG1 subclass and kappa light chain of 1E5, 2A2 and 3A5 clones.
  • Figure 21 shows aglycosylation of 1E5, 2A2 and 3A5 clones.
  • FIG. 22 shows genotype of FUT8 ⁇ / ⁇ mutant cell line clones with mutated nonsense mutations.
  • Figure 23 shows the lack of binding of PhoSL to FUT8 -/- HEK293-T cells.
  • Figure 24 shows the results of immunoblot analysis using anti-hAFP antibodies to quantify other glycoforms of AFP.
  • FIG. 25 is a diagram showing the results of mass spectrometry confirming that AFP-L3 was not present in FUT8 ⁇ / ⁇ cells and that the production rate of AFP-L3 was 99.5% in wild type cells.
  • FIG. 26 is a graph showing the results of standard curve analysis for a glycosylated antibody showing excellent linearity in the range of 0-20 ng / mL AFP as compared to the commercially available antibody.
  • FIG. 27 is a graph showing standard curves excellent in sensitivity and linearity according to lectin ELISA analysis using AAL and a sugar-free antibody for L3-positive AFP samples.
  • FIG. 28 is a graph showing standard curves with good linearity in the range of 0-100 ng / mL when AFP-L3 standard molecules are spiked into normal serum showing AFP levels below 1.0 ng / mL.
  • FIG. 29 is a graph showing% AFP-L3 values for AFP concentrations following a glycosyl-based lectin-ELISA hAFP test and ⁇ -TAS analysis.
  • 30 is a diagram showing the stability of the sugar-free antibody against thermal conditions.
  • 31 is a diagram showing the stability of the sugar-free antibody to pH conditions.
  • 32 is a diagram showing the stability of the sugar-free antibody to the oxidation conditions.
  • One aspect of the invention is a nucleotide sequence encoding one or more gRNA (guide RNA) that hybridizes to DNA encoding an IgG (immunoglobulin G) gene; Nucleotide sequences encoding Cas9 proteins; Nucleotide sequences encoding adenine base editors (ABEs); And it provides a recombinant expression vector or RNA produced from the recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.
  • gRNA guide RNA
  • an adenine base editing system specifically modifying the IgG gene of a cell line or fertilized egg, or by applying a transgenic somatic cloning technique, to the fallopian tubes of surrogate mothers other than humans.
  • a method of preparing an animal model for producing an antibody free of saccharide comprising a step of transplanting a fertilized egg, a method of producing a transformed animal producing an saccharide free antibody, and a use of a saccharide antibody produced from a transgenic animal.
  • adenine base editing system refers to a single base calibration induction system consisting of a nickase Cas9-hypothetical deoxyadenosine deaminase fusion protein (Adenine base editor (ABE) and gRNA (guide RNA)).
  • ABE nickase Cas9-hypothetical deoxyadenosine deaminase fusion protein
  • gRNA guide RNA
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • microbial immune systems are genome editing systems designed to replace adenine in the desired gene sequence with guanine without cutting DNA.
  • ABE adenine base editor
  • ABE is an essential protein element in the adenine base editing system, and is a nickase-Cas9 hypothetical deoxyadenosine deaminase fusion protein that can induce a single base calibration by forming a complex with gRNA.
  • the ABE protein may be developed by David R. Liu in 2017.
  • base editor refers to a protein that mediates modifications in genomic DNA more efficiently than the existing CRISPR / Cas9 system, and specifically converts 'GC to AT' or 'AT to GC'. Used for base editing system.
  • modification of the IgG gene was induced using an adenine base editor that induces 'A-T to G-C' conversion.
  • gRNA refers to an RNA including a base sequence capable of complementarily binding to a target DNA.
  • the gRNA may be complexed with a Cas9 protein or a nickase-Cas9 moiety in an adenine base editor. It is a single-chain RNA that can bring Cas9 protein or adenine base editor protein into target DNA.
  • Transformation of the fertilized egg or cell using the recombinant expression vector or RNA of the present invention can deliver the gRNA fragment in the cell, and the delivered gRNA fragment can recognize the IgG gene.
  • transforming the fertilized egg or cell using a recombinant expression vector or RNA can deliver the gRNA in the cell, and the delivered gRNA can serve to form a structure that can be recognized by the adenine base editor or Cas9 protein complex. .
  • modification refers to converting a sequence encoding a specific amino acid in a nucleotide sequence into a sequence encoding another amino acid.
  • recombinant expression vector refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.
  • operably linked means a functional bond between a gene expression control sequence and another nucleotide sequence.
  • the gene expression control sequence may be at least one selected from the group consisting of a replication origin, a promoter, a transcription terminator, and the like.
  • the transcription termination sequence may be a polyadenylation sequence (pA)
  • the origin of replication may be f1 origin, SV40 origin, pMB1 origin, adeno origin, AAV origin or BBV origin, but is not limited thereto. .
  • promoter refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.
  • the promoter according to one embodiment of the present invention is one of transcriptional regulatory sequences that regulate transcription initiation of a particular gene, and may be a polynucleotide fragment of about 100bp to about 2500bp in length. Promoters can be used without limitation as long as they can regulate transcriptional initiation in cells, such as eukaryotic cells (eg, plant cells, or animal cells (eg, mammalian cells such as humans, mice, etc.)).
  • eukaryotic cells eg, plant cells, or animal cells (eg, mammalian cells such as humans, mice, etc.)
  • the promoter may be a CMV promoter (e.g., a human or mouse CMV immediate-early promoter), a U6 promoter, an elongation factor 1-a (EF1-alpha) promoter, an EF1-alpha short (EFS) promoter, SV40 promoter, adenovirus promoter, pL ⁇ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, tk promoter of HSV, SV40E1 promoter, Respiratory syncytial virus virus (RSV) promoter, metallothionin promoter, ⁇ -actin promoter, ubiquitin C promoter, human interleukin-2 gene promoter, human lymphotoxin gene promoter and human GM -CSF (human granulocyte-macrophage colony stimulating factor) gene promoter may be selected from the group consisting of, but is not limited thereto It is not.
  • Recombinant expression vectors may be selected from the group consisting of viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retrovirus vectors and adeno-associated virus vectors.
  • Vectors that can be used as recombinant expression vectors include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1).
  • phage e.g., ⁇ gt4 ⁇ B, ⁇ -Charon, ⁇ z1, M13, etc.
  • viral vectors e.g., adeno-associated virus (AAV) vectors, etc. It may be produced as a basis, but is not limited thereto.
  • the recombinant expression vector of the present invention may further comprise one or more selectable markers.
  • the marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, which corresponds to all genes that can distinguish transfected cells from non-transfected cells.
  • herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, ampicillin, kanamycin, G418, bleomycin It may be, but is not limited to, antibiotic resistance genes such as hygromycin and chloramphenicol.
  • Construction of the recombinant expression vector of the present invention can be prepared using genetic recombination techniques well known in the art, site-specific DNA cleavage and ligation can be carried out using enzymes generally known in the art. have.
  • RNA produced from the recombinant expression vector of the present invention refers to mRNA synthesized in vitro using the recombinant expression vector as a template.
  • the IgG may be one or more IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.
  • a sugar-free antibody can be produced from the mouse.
  • all of the IgG1, IgG2b, IgG2c and IgG3 are modified.
  • by fixing the IgG gene thus modified by repetitive back cross of the mouse it is possible to establish a mouse strain for the production of a saccharide-free antibody.
  • the gRNA may comprise a nucleotide sequence complementary to any one sequence selected from the group consisting of SEQ ID NOs: 2 to 5.
  • Another aspect of the present invention provides a transformed cell line or fertilized egg for the production of an animal model for the production of aglycosylated antibody into which the recombinant expression vector or RNA is introduced.
  • fertilized eggs were obtained by crossing wild-type C57BL / 6 mice, but are not limited thereto.
  • Methods known in the art for introducing nucleic acid molecules into fertilized eggs or embryos can be used and can be carried out by selecting suitable standard techniques as are known in the art. Such a method may include, but is not limited to, for example, electroporation, microinjection, and the like.
  • a method known in the art may be used to introduce a nucleic acid molecule into an organism, cell, tissue or organ.
  • a suitable standard technique can be selected and performed according to the host cell.
  • Such methods include, for example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic Liposome method, and lithium acetate-DMSO method and the like may be included, but is not limited thereto.
  • the type of cell to be used as a transformed cell line may be an animal cell or a cell derived from an animal cell, preferably an animal used for producing an antibody such as a mammal, preferably a mouse, a rabbit or a goat, or a somatic cell or fertilized egg derived from these animals, and It may be an embryo, most preferably a mouse or somatic cells or fertilized eggs and embryos derived from a mouse. Using somatic cells derived from mice as a transgenic cell line can improve the problem of mouse death shortly after birth.
  • Another aspect of the present invention provides a method for producing an animal model for the production of a saccharide-free antibody comprising the step of implanting the fertilized egg into the fallopian tube of the surrogate mother, except for humans.
  • the production method of the animal model for the production of glycoside-free antibodies may be by somatic cell nuclear transfer (SCNT).
  • SCNT somatic cell nuclear transfer
  • Somatic cell nuclear transfer is a genetic manipulation technique that allows birth of progeny without passing through meiosis and hemichromosomal-bearing germ cells, which are commonly found in the reproductive process. It is a method of producing a fertilized egg and transplanting the fertilized egg in vivo to generate a new individual.
  • nuclear transplant refers to an egg into which a nuclear donor cell is introduced or fused
  • fusion refers to the binding of a nuclear donor cell to a lipid membrane portion of an egg.
  • the lipid membrane can be a plasma membrane or nuclear membrane of a cell. Fusion can occur by applying electrical stimulation when the nuclear donor cell and the egg are located adjacent to each other or when the nuclear donor cell is located in the perivitelline space of the nucleus pulposus egg.
  • the transformed cell line is a nuclear donor cell, and refers to a cell or a cell nucleus that delivers a nucleus to an egg, which is a nuclear receptor.
  • the egg preferably refers to a mature egg that has reached the second meiosis, and may preferably be an egg of a mouse.
  • the animal may be a rabbit, goat or mouse (mouse), but is not limited thereto.
  • mice have already been used for the study of pathological mechanisms and treatments of various diseases. Especially, since mice have been recognized as economic animals for a long time, they can avoid ethical problems than other middle and large animals as disease models, and are stable. Because the breeding system is built, it is easy to maintain and manage when developing the experimental animal model. In addition, rabbits and goats have already been utilized in a variety of antibodies production, it can be easily utilized in the production of the sugar-free antibody of the present invention. Chickens, horses and other animals that can produce antibodies can also be used.
  • the production of the sugar-free antibody may be by modification of one or more IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.
  • the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40;
  • the sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37;
  • the sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38;
  • the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.
  • Another aspect of the present invention provides an animal model for the production of a glycosylated antibody in which an IgG (immunoglobulin G) gene is modified.
  • IgG immunoglobulin G
  • the modification comprises the substitution of one or more amino acids of the N-S-T sequence in the amino acid sequence of the IgG1 heavy chain with another amino acid; In the amino acid sequence of an IgG2b heavy chain one or more amino acids of the N-S-T sequence are replaced with another amino acid; One or more amino acids of the N-S-T sequence in the amino acid sequence of an IgG2c heavy chain are replaced with another amino acid; And one or more amino acids in the N-S-T sequence in the amino acid sequence of the IgG3 heavy chain may be generated by one or more substitutions selected from the group consisting of substitution with other amino acids.
  • the modification is amino acid N in the N-S-T sequence in the amino acid sequence of the IgG1 heavy chain is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S;
  • amino acid sequence of an IgG2b heavy chain amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S;
  • amino acid sequence of the IgG2c heavy chain amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S;
  • one or more substitutions selected from the group consisting of amino acid N in the NST sequence in the amino acid sequence of the IgG3 heavy chain is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S It may have occurred.
  • NST to DST unlike mutations to DGT or GST, are asparagine, even though they have charged side chains, because N-glycosylated asparagine residues are located in an exposed loop between two strands of an immunoglobulin ⁇ -sandwich fold.
  • Aspartic acid which exhibits the same geometry as, is preferred since it can avoid potential geometrical structural instability compared to glycine (GST).
  • the N-S-T sequence may be amino acid sequence 297 to 299 of any one of the IgG heavy chain selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.
  • the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40;
  • the sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37;
  • the sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38;
  • the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.
  • the animal may be a rabbit, goat or mouse, but is not limited thereto.
  • Another aspect of the present invention provides a method for producing a glycosyl antibody against an antigen comprising administering an antigen to be diagnosed to the animal model.
  • the method for producing a sugar-free antibody may include a step of separating and purifying the sugar-free antibody from the transgenic mouse after antigen administration. Separation and purification of the antibody may be a method known in the art, a separation method using a column or a separation method using protein G agarose beads, and the like, but is not limited thereto.
  • Another aspect of the present invention provides a sugar free antibody produced by the method for producing a sugar free antibody.
  • the sugar-free antibody produced by the method of the present invention is an antibody which does not have an oligosaccharide added to the heavy chain of the antibody, that is, an antibody in which no glycosylation reaction has occurred, cross-linking by the sugar chain portion can be excluded, and thus, a variety of sugar chain researches It can be usefully used for molecular biological assays and kits for diagnosis of diseases.
  • Another aspect of the present invention is a sugar-free antibody; And it provides an immunodiagnostic kit comprising a glycoprotein biomarker.
  • the immunodiagnostic kit of the present invention may be, for example, using an immunodiagnostic strip.
  • the strip may include a sample pad to which a biological sample is absorbed; A conjugation pad comprising a sugar-free antibody that specifically binds to the disease antigen to be tested present in the biological sample; A test membrane including a test line in which a sugar-free antibody specifically binding to a disease antigen to be tested is immobilized and a control line in which a control antibody is immobilized; And it may include an absorption pad (absorption pad) that is absorbed the remaining amount of the sample after the reaction of the biological sample and each antibody, but is not limited thereto. In addition, it may further comprise a reagent generally used in the immunodiagnosis in the art.
  • Glycoprotein refers to a complex protein in which two to six kinds of monosaccharides and proteins are covalently linked, and are present in almost all cells in vivo. It is known to detect and recognize signals from outside the cell, to transport chemicals, and to be involved in various inflammations and diseases. Thus, by analyzing glycoproteins, diagnosis of various diseases is possible.
  • immunoassay refers to a method for confirming whether a disease is infected, onset, course or the like, based on an antigen-antibody response that specifically reacts, enzyme immunoassay, fluorescence Immunoassay methods, and the like, but are not limited thereto.
  • the glycoprotein biomarker can be detected by lectin.
  • the term "lectin” refers to a protein that specifically binds to a specific sugar molecule, and may be used to identify oligosaccharides modified in a protein in the field of molecular diagnostics.
  • the lectin is L4-PHA (Phytohemagglutinin-L4), LCA (lens culinaris agglutinin), DSA (Datura stramonium agglutinin), AAL (Aleuria aurantia agglutinin), Selectin (Selectin), Con A ( Concanavalin-A), heat germ agglutinin (WGA), jacalin (Jacalin), Sambucus Nigra agglutinin (SNA), galectin (galectin), but is not limited thereto.
  • the glycoprotein may be AFP-L3, but may include biomarkers that are specifically effective for diagnosis in a specific disease.
  • AFP-L3 levels are increased in liver cancer patients, and CA-125 (mucin 16, MUC16) levels are known to increase in cirrhosis and ovarian cancer patients. Since the lectin cannot bind to the sugar-free antibody, the kit of the present invention can accurately measure the presence and amount of glycoproteins contained in a biological sample. Specifically, the present invention specifically confirmed that it is possible to reliably diagnose liver cancer by measuring the amount of AFP-L3 using AAL as the sugar-free antibody produced from the animal model for producing the sugar-free antibody of the present invention.
  • the method for analyzing glycoprotein using the immunodiagnostic kit of the present invention may additionally use a protein analysis method known in the art, for example, Western blot, ELISA ( Enzyme Linked Immunosorbent Assay (OTA), radioimmunoassay (otA: badioimmunoassay), radioimmunoassay, electrophoresis, immunoprecipitation assay, FACS and protein chip methods may be used, but is not limited thereto.
  • OTA Enzyme Linked Immunosorbent Assay
  • otA badioimmunoassay
  • electrophoresis radioimmunoassay
  • immunoprecipitation assay FACS and protein chip methods
  • pCMV-ABE7.10 addgene, # 102919
  • xCas9 3.7) -ABE (7.10)
  • plasmid vectors were purchased from Addgene. Plasmids were digested with AgeI (NEB) for 2 hours at 37 ° C. and the linearized vector was purified using a PCR purification kit (QIAGEN). 1 ⁇ g of the purified vector was used as a template for mRNA synthesis using the mMESSAGE mMACHINE T7 Ultra kit (Thermo Fisher Scientific). mRNA was isolated using a MEGAclear kit (Thermo Fisher Scientific), aliquoted into frozen tube vials and stored in liquid nitrogen. The base sequence of the used ABE is shown in Table 1.
  • hCG hormone 5IU was injected into the abdominal cavity of C57BL / 6J female mice (5 weeks old) at 48 hour intervals.
  • Female mice were crossed with 9-week-old C57BL / 6J male mice, and one-cell conjugates were obtained from the ampulla of oviduct of female mice. Cumulus cells were removed by culturing in M2 medium containing 3mg / ml hyaluronidase (Merck).
  • a mixture comprising 3 ug / ⁇ l of ABE mRNA having the nucleotide sequence of Table 1 of Example 1-2 and 3 ug / ⁇ l of sgRNA (Toolgen, Korea) for binding target DNA was prepared by a LEICA DMIRB remote controller (Leica-microsystems). Microinjection was made in the cytoplasm of the conjugates using a fitted Femtojet microinjector (Eppendorf, Germany).
  • CRISPR target sequence (5 ' ⁇ 3') SEQ ID NO: Ighg1 TCAACAGCACTTTCCGTTC AGT SEQ ID NO: 2 Ighg2b TACAACAGTACTATCCGGG TGG SEQ ID NO: 3 Ighg2c TACAACAGTACTCTCCGGG TGG SEQ ID NO: 4 Ighg3 TACAACAGTACCTTCCGAG TGG SEQ ID NO: 5
  • sgRNA and 400ng / ⁇ l of ABE mRNA prepared in Example 1-2 were dissolved in opti-MEM (Gibco) to prepare a mixture for electroporation.
  • the conjugate was suspended in the electroporation mixture and electroporated using a NEPA 21 electroporator (NEPA GENE) according to the manufacturer's protocol.
  • the incubator was incubated in KSOM + AA medium (Millipore) up to 2 cell stages in a 37 ° C. incubator supplemented with 5% CO 2 , followed by surviving cells of pseudo-pregnant surrogate mice. Implanted in the fallopian tube.
  • Toes were cut from a 1 week old pup to isolate genomic DNA.
  • pre-selection of genotyping was carried out using the primers of Table 3 by an amplification refractory mutation system (ARMS) using H-Taq (Biofact) and a sample having only guanine bands at the target site.
  • ARMS amplification refractory mutation system
  • H-Taq Biofact
  • Sanger sequencing analysis The final mutation was PCR amplified the target locus using Pfu and specific primers (Table 4). The PCR product was confirmed by Sanger sequencing analysis method.
  • Antigenic solution was prepared by dissolving 50 ⁇ g of human AFP (Mybiosource) in 100 ⁇ l of TiterMax Gold adjuvant (Merck), and injected 4 times at 1 week intervals into the sole of the genome edited mouse (6 weeks old). After the final injection, the popliteal lymph nodes were dissected to obtain B cells and then fused with FO myeloma cells according to conventional methods.
  • human AFP Mybiosource
  • TiterMax Gold adjuvant Merck
  • Single fusion cells were placed in a petri dish and 20% FBS, 1xHAT (100uM hypoxanthine, 0.4uM aminopterin and 16uM thymidine) (Merck), 1x antibiotic-antibacterial solution (100units / ml penicillin, 100ug / ml streptomycin sulfate and 0.25 ⁇ g / ml Cultured for 2 weeks with amphotericin B) (Welgene, Korea). Positive clones producing antibodies against hAFP were selected using the indirect ELISA assay. Human AFP solutions were prepared by dissolving hAFP in PBS at a concentration of 1 ⁇ g / ml.
  • Antigen solution 100 ⁇ l was used to coat the surface of a 96-well plate (Thermo Fisher scientific). After blocking, the culture medium was diluted 100-fold and added to the wells of the coated plate and incubated. After washing three times with TBS-Tween20 (0.02%), HRP (Cell Signaling Technology, Dilution Ratio: 1: 2000) was treated with the anti-mouse secondary antibody conjugated and TMB-ultra solution (Thermo Fisher Scientific) Was treated. After stopping the chemical reaction by adding 100 ⁇ l of 0.2NH 2 SO 4 , absorbance at 450 nm was measured using a VERSA max microplate reader (Molecular Devices). In order to produce aglycosylated monoclonal antibodies, positive clones were cultured in serum-free medium (Gibco).
  • Hybridoma cells prepared in Example 1-5 were cultured in serum-free medium (Gibco) while stirring at 100 RPM for 72 hours in a chamber supplemented with 5% CO 2 .
  • Conditioned media was obtained, cell debris was removed by centrifugation at 13,000 g for 30 minutes, and the remaining debris was removed by filtration with a 0.22 ⁇ m syringe filter (Millipore).
  • the filtrate was purified by HiTrap TM Protein G HPcolumn (GE healthcare Life Sciences) using an FPLC system (AKTA Water Purifier, GE healthcare Life Sciences).
  • the filtrate was passed through a column equilibrated with PBS (phosphate-buffered saline) buffer at a flow rate of 1 ml / min, and the bound protein was eluted with 50 mM glycine-HCl (pH 2.5) at a flow rate of 3 ml / min.
  • the eluted fractions were neutralized with 1M Tris-HCl, pH 8.0, then mixed with protein stabilized cocktail solution (Thermo Fisher Scientific) and stored at -20 ° C.
  • FUT8 targeting guide RNA constructs (Table 5) were generated by cloning hybridized oligonucleotide pairs to pSpCas9 (BB) -2A-Puro (PX459) (Addgene plasmid # 48139) vector.
  • CRISPR target sequence (5 ' ⁇ 3') SEQ ID NO: Fut8-e9-sgRNA # 1 TACTACCTCAGTCAGACAGA SEQ ID NO: 34 Fut8-e9-sgRNA # 2 AACCAGTTCTGTCAGATCTT SEQ ID NO: 35 Fut8-e11-sgRNA # 1 CACCCAGCGAACACTCATCT SEQ ID NO: 36
  • HEK293-T cells 8 ⁇ 10 5 cells were transformed using an electroporator (Neon, Invitrogen) of voltage 1300 V, pulse width 10 ms and pulse number 3 using a vector construct (10 ⁇ g). Single cells were aliquoted into each well to form clones, and FUT8 ⁇ / ⁇ clones were selected by genotyping for each clone by Sanger sequencing analysis.
  • Microchip capillary electrophoresis and liquid-phase binding assays were performed on an automatic analyzer (mTAS Wako i30, Wako Pure Chemical Industries, Osaka, Japan) to provide alpha in residual serum samples.
  • Fetal protein (alpha-fetoprotein) AFP-L3 was measured. Measurements ranged from 0.3 to 2000 ng / mL for AFP, and AFP-L3 concentrations were calculated in serum with AFP concentrations greater than 0.3 ng / ml. If the AFP concentration of the sample was more than 2,000 ng / mL, the sample was manually diluted based on existing results according to the manufacturer's instructions. All tests were performed at Yangsan Hospital, Pusan National University, and no information was provided on subjects before the test.
  • HEK293-T cells (2 ⁇ 10 4 ) were grown for 1 day on 18 mm ⁇ 18 mm cover glass in DEME medium. Cells were fixed for 12 hours with BD cytofix / cytoperm solution (BD bioscience). Cells were then incubated in the presence of 9 ng / ul PhoSL-alexa488 for 2 hours at room temperature. After washing three times with PBS, the cover glass was covered with a Vectashield mounting medium (VECTOR Laboratories) containing 1.5 ⁇ g / ml DAPI. Fluorescence was monitored by a Zeiss LSM510 Meta microscope (Carl Zeiss MicroImaging).
  • ELISA well plates were coated overnight at 4 ° C. with 0.5 ⁇ g of anti-hAFP mouse monoclonal antibody (# ab54745, Abcam) or anti-hAFP glycosylated antibody dissolved in 0.1 M sodium bicarbonate in buffer (pH 7.4). . Plates were washed twice with TBS-0.1% Tween 20 and blocked for 1 hour at room temperature using proteinless blocking buffer (Thermo Fisher Scientific) or 0.5% polyvinylalcohol + 0.1% Tween 20. Each well was dispensed with clinical sample or culture medium (100 ⁇ l).
  • Deglycosylated antibodies were incubated at 100 ° C. for 15 minutes by incubating 10 units of commercially available anti-hAFP antibody (# MIA1305, Thermo fisher Scientific) with 100 units of PNGase-F (NEB) in Rapid PNGase F non-reducing buffer. Ready Time dependent and temperature dependent protein stability was determined by incubating glycosylated, deglycosylated, or glycosylated antibodies in PBS buffer at 4 ° C. or 37 ° C. for up to 14 days. Incubated antibodies were electrophoresed on 4-20% Mini-Protein TGX TM gel (BioRad) and visualized by Coomassie Blue staining.
  • Protein stability was monitored by incubating the antibody for 0-14 days in 0.1M phosphate buffer adjusted to pH 3.0, 7.0 or 10.0. In addition, each antibody was incubated in a 37 ° C. incubator for 5 hours in PBS buffer containing 0-3% H 2 O 2 . Integrity of the antibodies was measured by the ELISA assay described above.
  • Immunoglobulin G is an N-linked glycoprotein, which, like normal glycoproteins, exhibits heterogeneity in glycan structures. Because of these properties, the use of routinely used immunoassays such as ELISA or CLIA has been limited in measuring disease specific glycol-biomarkers using glycan specific probes including lectins. On the other hand, lectins can bind to capture antibodies even when no analyte is present (FIG. 1), and glycan structures are difficult to predict, and batch-to-batch modifications are easy, resulting in uncontrolled significant blanks (blank). value).
  • Non-homologous end joining NHEJ
  • a base editing system has been developed that enables 'C-G to T-A' or 'A-T to G-C' conversion, respectively, with high efficiency by cytosine or adenine base-based editing, without cleavage of double stranded DNA.
  • Sequence analysis of the IgG gene of C57BL / 6 showed that within the base editing window (FIG. 3) IgG2b, IgG2c and IgG3 share an editable adenine to the N-glycosylated asparagine coding sequence (AAC). Conversion of one or both adenine to guanine produces a non-asparagine coding sequence that results in the disappearance of N-glycans in IgG.
  • ARMS amplification refractory mutation system
  • the pups resulting from the crossover of genome edited pups and wild type C57BL / 6 mice were repeatedly crossed and propagated with heterozygous mutant pups and fixed to have one of the mutant amino acid motifs D-S-T, D-G-T, G-S-T and G-G-T. Since the DST mutation is located in an exposed loop between two strands of the immunoglobulin ⁇ -sandwich folds, the N-glycosylated asparagine residues, aspartic acids, which have the same geometry as the asparagine, are glycine (GST) As the intermediate founder was selected, DST mutations were chosen because potential geometric instability could be avoided. The introduction of two mutations, such as D-G-T or G-S-T, was excluded to minimize modification of the construct (FIG. 12). The intermediate founder was bred and used for IgG1 gene editing.
  • the target site of IgG1 does not contain canonical (NGG), but both strands of the target contain only the NG PAM sequence. Therefore, HDR mediated gene editing was performed using donor DNA targeting the possible adjacent sites, but could not produce pups with edited IgG1 gene. Therefore, for gene editing of IgG1, IgG1 gene was edited according to Example 1-3 using xCas9-ABE of Example 1-2 showing gene targeting activity for NG sequence.
  • Subclass Way Effector protein Effector / gRNA Amino acid modification Number of adapters Pups born Mutants (monoallelic / biallelic) collection Injection transplantation IgG1 Adenine base editing xCas9-ABE7.10 mRNA / RNA NST ⁇ SST 211 196 32 10 7/0 IgG2b ABE7.10 NST ⁇ DST 405 317 112 24 10/11 IgG2c 12/7 IgG3 5/10
  • IgG immunoglobulin G
  • IgG profiling was performed using an immunoglobulin isotyping kit against the genomic edited mouse derived IgG established in Example 2 to confirm that a defective IgG was produced.
  • mice knocked out of the IgG2b (FIG. 15) and IgG3 (FIG. 16) genes were found to exhibit defects in the production of the corresponding subclass.
  • mice After immunization, swarm lymph node cells were harvested from mice and fused with FO myeloma cells according to Examples 1-5, and colonies of hybridoma cells were formed on plates containing hypoxanthine-aminopterin-thymidine (666) to 666 Hybridoma clones were obtained.
  • FO myeloma cells After immunization, swarm lymph node cells were harvested from mice and fused with FO myeloma cells according to Examples 1-5, and colonies of hybridoma cells were formed on plates containing hypoxanthine-aminopterin-thymidine (666) to 666 Hybridoma clones were obtained.
  • the anti-hAFP antibody may cross-react to epitopes present in human serum albumin (HAS), thus responsiveness to HAS was excluded and reactive clones were excluded.
  • HAS human serum albumin
  • three clones designated as 1E5, 2A2, and 3A5 were selected by selecting clones in which antibody production continued, except for clones whose antibody production decreased over time. All three clones were found to secrete monoclonal antibodies of IgG1 subclass and kappa light chain (FIG. 19).
  • MS analysis confirmed that there were no post-translational modifications, such as O-linked glycosylation, in the newly formed mutant regions.
  • HEK293-T cells express FUT8 (alpha- (1,6) -fucosyltransferase), which catalyzes the fucose transfer from GDP-fucose to core N-glycans.
  • FUT8 alpha- (1,6) -fucosyltransferase
  • hAFP was overexpressed in both wild-type and FUT8 ⁇ / ⁇ HEK293-T cells, and conditioned media was obtained for lectin affinity electrophoresis. Protein electrophoresis was performed on an agarose gel containing Lens culinaris agglutinin so that AFP-L3 and AFP-L1 exhibited different mobility. Immune blot analysis using anti-hAFP antibodies to visualize other glycoforms of AFP (FIG. 24). AFP-L3 accounts for the majority of AFP glycoforms obtained from wild-type HEK293-T cells, whereas FUT8 ⁇ / ⁇ cells were found not to produce AFP-L3.
  • Standard curves were prepared by lectin-coupled ELISA analysis using canonical sandwich ELISA and AAL.
  • a sugar-free antibody (1E5) or a commercial antibody was used as a capture antibody.
  • Detection antibody pairs were selected from among commercially available antibodies that matched capture antibodies.
  • the glycosylated antibody showed excellent linearity in the range of 0-20 ng / mL AFP (FIG. 26).
  • ⁇ -TAS is an in vitro diagnostic immunoassay that electrophorically analyzes the transport of AFP-L3 in LCA-embedded capillaries. Because of the high sensitivity and robustness of the analyzer and the clinical usefulness of the AFP-L3 measurement, ⁇ -TAS has received FDA approval of in vitro tests for risk assessment of HCC progression. Despite the analytical validity and clinical utility, the ⁇ -TAS assay has some limitations in clinical use. As it is generally a costly assay, routine clinical use for cancer screening is limited. In addition, ⁇ -TAS was developed for the use of AFP-L3 and is difficult to use for other glycoform analysis.
  • the ALIQUAT method can provide a universal and universal platform for the detection of various disease specific forms.
  • the ALIQUAT platform can be easily applied to the testing of other disease specific glycoforms only when glycoform specific probes and sugar-free antibodies are available. Since a variety of lectins with specificity for tumor specific biomarkers are already available, in order to determine if aglycosyl antibodies that can be readily produced from the genome edited mice of the invention can be applied to the ALIQUAT method, 1E5) is conjugated to magnetic beads to detect hAFP in serum and the clinical sample is applied to a chemiluminescent immunoassay (CLIA) platform where the fucosylated form is traced to AAL to confirm the validity of the assay. It was.
  • CLIA chemiluminescent immunoassay
  • Protein glycosylation exhibits a variety of effects, including protein function, protein-protein interactions, and cell-host recognition. Protein glycans are also known to confer protein stability in vivo and in vitro (Bowden 2012). Thus, it was confirmed in accordance with Examples 1-11 whether the antibody lost protein stability during storage and testing by deglycosylation.
  • glycosylated antibodies and deglycosylated forms of antibodies produced by PNGase-F treatment were compared as controls.
  • Antibodies can be exposed to changes in pH during various reaction conditions or purification procedures. Therefore, the stability of various glycoform antibodies at various pH conditions was investigated.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Mycology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to a transgenic mouse for aglycosylated antibody production and a use of the aglycosylated antibody produced therefrom. The transgenic mouse of the present invention can be used to easily produce aglycosylated antibodies to various target antigens and the aglycosylated antibodies thus produced can precisely detect glycoprotein biomarkers, thus achieving the accuracy of disease diagnosis.

Description

무당질 항체 생산용 형질전환 마우스 및 이로부터 생산된 무당질 항체의 용도Use of Transgenic Mice for the Production of Glucose-Free Antibodies and Glucose-Free Antibodies

본 발명은 무당질 항체 생산용 형질전환 마우스, 이로부터 생산된 목적 항원에 대한 무당질 항체 및 생산된 무당질 항체로 당단백질 바이오마커를 분석하여 질병을 진단하는 방법에 관한 것이다.The present invention relates to a method for diagnosing a disease by analyzing a glycoprotein biomarker with a transformed mouse for producing a glycoside antibody, a glycoside antibody against a target antigen produced therefrom, and a produced glycoside antibody.

본 발명은 과학기술정보통신부의 과제번호 1711064732, "유전자 편집을 통한 무당쇄 항체 생산시스템 개발"에 따른 한국 정부의 지원을 받아 이루어졌다.The present invention was made with the support of the Korean government according to task number 1711064732, "Development of a sugarless antibody production system through gene editing," of the Ministry of Science and Technology.

또한, 본 발명은 국가과학기술연구회의 과제번호 NTM2371813, "비임상시험용인간당쇄모사모델마우스개발"에 따른 한국 정부의 지원을 받아 이루어졌다.In addition, the present invention was supported by the Korean government in accordance with the National Science and Technology Research Council task number NTM2371813, "Development of Non-Clinical Human Sugar Chain Model Mouse."

또한, 본 발명은 과학기술정보통신부의 과제번호 KGM5181813, "주요사업(2015-2018)"에 따른 한국 정부의 지원을 받아 이루어졌다.In addition, the present invention was made with the support of the Korean government according to the task number KGM5181813, "Main Project (2015-2018)" of the Ministry of Science and Technology Information and Communication.

질병 진단을 위한 마커로 당단백질(glycoprotein), 질병 특이적 항원 등이 이용되고 있다. 예를 들어, 전립선암의 전립선-특이적 항원(prostate-specific antigen, PSA), 대장암의 암태아성 항원(carcinoembryogenic antigen, CEA), 고환암 및 간암 진단을 위한 알파-태아단백질 (alpha-fetoprotein; AFP) 등이 있다. 이러한 마커들은 질병 진행 과정에서 마커의 양적 증가뿐만 아니라 단백질에 결합되어 있는 당쇄 또한 변하는 것으로 알려져 있다.Glycoproteins, disease-specific antigens, and the like are used as markers for diagnosing diseases. For example, prostate-specific antigen (PSA) of prostate cancer, carcinoembryogenic antigen (CEA) of colorectal cancer, alpha-fetoprotein (AFP) for the diagnosis of testicular cancer and liver cancer ). These markers are known to change not only the quantitative increase of markers but also the sugar chains bound to proteins during disease progression.

면역글로불린(immunoglobulin, Ig, 항체)은 질병 진단 분야에서 폭넓게 사용되는 도구이며, IgG 유형 항체가 진단 시장을 가장 크게 점유하고 있다. IgG는 이황화 결합으로 연결된 2개의 중쇄(heavy chain)와 2개의 경쇄(light chain)로 이루어져 있다. IgG는 중쇄의 CH2 불변 도메인(constant domain)에 존재하는 Asn297 자리에 당쇄 수식이 일어난다(N-당질화). N-당질화는 Asn-X(Pro 외)-Ser/Thr 라는 보존된 서열(consensus sequence)에서 일어난다. 당단백질을 표적으로 하는 질병진단 분야에서 IgG의 당쇄는 진단 결과를 교란시키는 중요한 요소이다. 일 예로 렉틴(lectin)은 당단백질 등의 당쇄를 확인하기 위해 사용되나, IgG의 당쇄에까지 교차결합하여 분석 결과를 혼동시킬 수 있다. 이러한 문제를 해결하기 위하여 항체의 당쇄 부분을 제거하려는 노력이 있어왔고, PNGase 절단법, 펩신 절단법, 크로스-링커(cross-linker) 방법 등이 수행되었다. 그러나 이 방법들은 효소 반응과 화학 반응의 효율이 완벽하지 못하며, 처리 후 IgG 회수가 어렵다는 한계를 가지고 있다. 따라서, 항체의 당쇄 문제를 근본적으로 해결할 필요가 요구되고 있다. Immunoglobulins (Ig, antibodies) are widely used tools in the field of disease diagnosis, and IgG type antibodies dominate the diagnostic market. IgG consists of two heavy chains and two light chains linked by disulfide bonds. IgG undergoes sugar chain modification at the Asn297 site in the CH2 constant domain of the heavy chain (N-glycosylation). N-glycosylation occurs in a consensus sequence called Asn-X (ex. Pro) -Ser / Thr. In the field of disease diagnostics targeting glycoproteins, the sugar chains of IgG are an important factor in disturbing diagnostic results. In one example, lectins are used to identify sugar chains such as glycoproteins, but they may cross-link to sugar chains of IgG to confuse analysis results. In order to solve this problem, efforts have been made to remove the sugar chain portion of the antibody, PNGase cleavage, pepsin cleavage, cross-linker (cross-linker) method and the like have been performed. However, these methods have limitations in the efficiency of enzymatic and chemical reactions and difficulty in recovering IgG after treatment. Therefore, there is a need for a fundamental solution to the sugar chain problem of antibodies.

본 발명자들은 마우스의 게놈 DNA에서 IgG 유전자를 편집하여 항체의 N-당질화 서열을 무당질화 서열로 변형시켰다. 또한 이렇게 제작된 마우스로부터 항체를 생산하여, 생산된 항체가 무당질항체임을 밝히고 이를 이용하여 ELISA와 CLIA 방법으로 AFP-L3를 정량적으로 분석할 수 있음을 증명함으로써 본 발명을 완성하였다.We edited the IgG gene in the genomic DNA of mice to modify the N-glycosylated sequence of the antibody to aglycosylated sequences. In addition, the present invention was completed by producing an antibody from the thus prepared mouse, revealing that the produced antibody is a glycoside-free antibody, and demonstrating that it is possible to quantitatively analyze AFP-L3 using ELISA and CLIA methods.

본 발명의 하나의 목적은 IgG(immunoglobulin G) 유전자를 암호화하는 DNA에 혼성화하는 하나 이상의 gRNA(guide RNA)를 암호화하는 뉴클레오티드 서열; Cas9 단백질을 암호화하는 뉴클레오티드 서열; ABE(adenine base editor)를 암호화하는 뉴클레오티드 서열; 및 상기 뉴클레오티드 서열에 작동가능하게 연결된 프로모터를 포함하는 재조합 발현벡터 또는 상기 재조합 발현벡터로부터 생산된 RNA를 제공하는 것이다.One object of the invention is a nucleotide sequence encoding one or more gRNAs (guide RNAs) that hybridize to DNA encoding an IgG (immunoglobulin G) gene; Nucleotide sequences encoding Cas9 proteins; Nucleotide sequences encoding adenine base editors (ABEs); And it provides a recombinant expression vector or RNA produced from the recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.

본 발명의 다른 목적은 상기 재조합 발현 벡터 또는 RNA가 도입된 무당질 항체(aglycosylated antibody) 생산용 동물모델의 제작용 형질전환 세포주 또는 수정란을 제공하는 것이다.It is another object of the present invention to provide a transformed cell line or fertilized egg for the production of an animal model for producing an aglycosylated antibody into which the recombinant expression vector or RNA is introduced.

본 발명의 또 다른 목적은 상기 수정란을 인간을 제외한 동물인 대리모의 난관에 이식하는 단계를 포함하는 무당질 항체 생산용 동물모델의 제조방법을 제공하는 것이다.Another object of the present invention is to provide a method for producing an animal model for the production of a sugar-free antibody comprising the step of transplanting the fertilized egg into the fallopian tube of the surrogate mother, except for human.

본 발명의 또 다른 목적은 IgG(immunoglobulin G) 유전자가 변형된 무당질 항체 생산용 동물모델을 제공하는 것이다.Still another object of the present invention is to provide an animal model for the production of a saccharide-free antibody in which an IgG (immunoglobulin G) gene is modified.

본 발명의 또 다른 목적은 상기 동물모델에 진단하고자 하는 항원을 투여하는 단계를 포함하는 항원에 대한 무당질 항체의 생산방법을 제공하는 것이다.Still another object of the present invention is to provide a method for producing a glycosyl antibody against an antigen comprising administering an antigen to be diagnosed to the animal model.

본 발명의 또 다른 목적은 상기 무당질 항체의 생산방법으로 생산된 무당질 항체를 제공하는 것이다.Still another object of the present invention is to provide a sugar free antibody produced by the method for producing a sugar free antibody.

본 발명의 또 다른 목적은 상기 무당질 항체; 및 당단백질 바이오마커를 포함하는 면역진단키트를 제공하는 것이다.Another object of the present invention is a sugar-free antibody; And it provides an immunodiagnostic kit comprising a glycoprotein biomarker.

본 발명의 일 양상은 IgG(immunoglobulin G) 유전자를 암호화하는 DNA에 혼성화하는 하나 이상의 gRNA(guide RNA)를 암호화하는 뉴클레오티드 서열; Cas9 단백질을 암호화하는 뉴클레오티드 서열; ABE(adenine base editor)를 암호화하는 뉴클레오티드 서열; 및 상기 뉴클레오티드 서열에 작동가능하게 연결된 프로모터를 포함하는 재조합 발현벡터 또는 상기 재조합 발현벡터로부터 생산된 RNA를 제공한다.One aspect of the invention is a nucleotide sequence encoding one or more gRNA (guide RNA) that hybridizes to DNA encoding an IgG (immunoglobulin G) gene; Nucleotide sequences encoding Cas9 proteins; Nucleotide sequences encoding adenine base editors (ABEs); And it provides a recombinant expression vector or RNA produced from the recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.

본 발명의 일 구체예에 따르면, 상기 IgG는 IgG1, IgG2a, IgG2b, IgG2c 및 IgG3으로 이루어진 군으로부터 선택되는 하나 이상의 IgG일 수 있다.According to one embodiment of the invention, the IgG may be one or more IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.

본 발명의 일 구체예에 따르면, 상기 gRNA는 서열번호 2 내지 5로 이루어진 군으로부터 선택되는 어느 하나의 서열에 상보적인 뉴클레오티드 서열을 포함할 수 있다.According to one embodiment of the invention, the gRNA may comprise a nucleotide sequence complementary to any one sequence selected from the group consisting of SEQ ID NOs: 2 to 5.

본 발명의 다른 양상은 상기 재조합 발현 벡터 또는 RNA가 도입된 무당질 항체(aglycosylated antibody) 생산용 동물모델의 제작용 형질전환 세포주 또는 수정란을 제공한다.Another aspect of the present invention provides a transformed cell line or fertilized egg for the production of an animal model for the production of aglycosylated antibody into which the recombinant expression vector or RNA is introduced.

본 발명의 또 다른 양상은 상기 수정란을 인간을 제외한 동물인 대리모의 난관에 이식하는 단계를 포함하는 무당질 항체 생산용 동물모델의 제조방법을 제공한다.Another aspect of the present invention provides a method for producing an animal model for the production of a saccharide-free antibody comprising the step of implanting the fertilized egg into the fallopian tube of the surrogate mother, except for humans.

본 발명의 일 구체예에 따르면, 상기 동물은 토끼, 염소 또는 마우스(mouse)일 수 있다.According to one embodiment of the invention, the animal may be a rabbit, goat or mouse.

본 발명의 일 구체예에 따르면, 상기 무당질 항체의 생산은 IgG1, IgG2a IgG2b, IgG2c 및 IgG3으로 이루어진 군으로부터 선택되는 하나 이상의 IgG의 변형에 의한 것일 수 있다.According to one embodiment of the present invention, the production of the sugar-free antibody may be by modification of one or more IgG selected from the group consisting of IgG1, IgG2a IgG2b, IgG2c and IgG3.

본 발명의 일 구체예에 따르면, 상기 변형은 서열번호 2에 해당하는 서열이 서열번호 40의 서열로 치환; 서열번호 3에 해당하는 서열이 서열번호 37의 서열로 치환; 서열번호 4에 해당하는 서열이 서열번호 38의 서열로 치환; 및 서열번호 5에 해당하는 서열이 서열번호 39의 서열로 치환으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것일 수 있다.According to an embodiment of the present invention, the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40; The sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37; The sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38; And the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.

본 발명의 또 다른 양상은 IgG(immunoglobulin G) 유전자가 변형된 무당질 항체 생산용 동물모델을 제공한다.Another aspect of the present invention provides an animal model for the production of a glycosylated antibody in which an IgG (immunoglobulin G) gene is modified.

본 발명의 일 구체예에 따르면, 상기 변형은 IgG1 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 다른 아미노산으로 치환; IgG2a 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 다른 아미노산으로 치환; IgG2b 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 다른 아미노산으로 치환; IgG2c 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 다른 아미노산으로 치환; 및 IgG3 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 다른 아미노산으로 치환으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것일 수 있다.According to one embodiment of the invention, the modification is amino acid N of the N-S-T sequence in the amino acid sequence of the IgG1 heavy chain substitution of another amino acid; Amino acid N in the amino acid sequence of the IgG2a heavy chain is substituted with another amino acid in the N-S-T sequence; Amino acid N in the amino acid sequence of the IgG2b heavy chain is substituted with another amino acid in the N-S-T sequence; Amino acid N in the amino acid sequence of the IgG2c heavy chain is substituted with another amino acid in the N-S-T sequence; And amino acid N in the N-S-T sequence in the amino acid sequence of the IgG3 heavy chain may be generated by one or more substitutions selected from the group consisting of substitution with other amino acids.

본 발명의 일 구체예에 따르면, 상기 N-S-T 서열은 IgG1, IgG2a IgG2b, IgG2c 및 IgG3로 이루어진 군으로부터 선택되는 어느 하나의 IgG 중쇄의 297번 내지 299번 아미노산 서열일 수 있다.According to one embodiment of the present invention, the N-S-T sequence may be amino acid sequence 297 to 299 of any one of the IgG heavy chain selected from the group consisting of IgG1, IgG2a IgG2b, IgG2c and IgG3.

본 발명의 일 구체예에 따르면, 상기 변형은 서열번호 2에 해당하는 서열이 서열번호 40의 서열로 치환; 서열번호 3에 해당하는 서열이 서열번호 37의 서열로 치환; 서열번호 4에 해당하는 서열이 서열번호 38의 서열로 치환; 및 서열번호 5에 해당하는 서열이 서열번호 39의 서열로 치환으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것일 수 있다.According to an embodiment of the present invention, the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40; The sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37; The sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38; And the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.

본 발명의 일 구체예에 따르면, 상기 동물은 토끼, 염소 또는 마우스 뿐만 아니라 항체를 생산할 수 있는 모든 동물일 수 있다.According to one embodiment of the invention, the animal may be any animal capable of producing antibodies as well as rabbits, goats or mice.

본 발명의 또 다른 양상은 상기 동물모델에 진단하고자 하는 항원을 투여하는 단계를 포함하는 항원에 대한 무당질 항체의 생산방법을 제공한다.Another aspect of the present invention provides a method for producing a glycosyl antibody against an antigen comprising administering an antigen to be diagnosed to the animal model.

본 발명의 또 다른 양상은 상기 무당질 항체의 생산방법으로 생산된 무당질 항체를 제공한다.Another aspect of the present invention provides a sugar free antibody produced by the method for producing a sugar free antibody.

본 발명의 또 다른 양상은 상기 무당질 항체; 및 당단백질 바이오마커를 포함하는 면역진단키트를 제공한다.Another aspect of the present invention is a sugar-free antibody; And it provides an immunodiagnostic kit comprising a glycoprotein biomarker.

본 발명의 일 구체예에 따르면, 상기 당단백질 바이오마커는 렉틴에 의해 검출될 수 있다.According to one embodiment of the invention, the glycoprotein biomarker can be detected by lectin.

본 발명의 일 구체예에 따르면, 상기 렉틴은 L4-PHA (Phytohemagglutinin-L4), LCA (lens culinaris agglutinin), DSA (Datura stramonium agglutinin), AAL (Aleuria aurantia agglutinin), 셀렉틴 (Selectin), Con A(Concanavalin-A), WGA (Wheat germ agglutinin), 자칼린 (Jacalin), SNA (Sambucus Nigra agglutinin) 또는 갈렉틴 (galectin)일 수 있다.According to one embodiment of the invention, the lectin is L4-PHA (Phytohemagglutinin-L4), LCA (lens culinaris agglutinin), DSA (Datura stramonium agglutinin), AAL (Aleuria aurantia agglutinin), Selectin (Selectin), Con A ( Concanavalin-A), Heat germ agglutinin (WGA), Jacalin (Jacalin), Sambucus Nigra agglutinin (SNA) or galectin.

본 발명의 일 구체예에 따르면, 상기 당단백질은 AFP-L3일 수 있다.According to one embodiment of the invention, the glycoprotein may be AFP-L3.

본 발명의 형질전환 마우스를 이용하면 다양한 목적 항원에 대한 무당질 항체를 손쉽게 생산할 수 있고, 생산된 무당질 항체로 당단백질 바이오마커를 정밀하게 검출하여 질병 진단의 정밀화를 도모할 수 있다.Using the transgenic mouse of the present invention, it is possible to easily produce a glycosylated antibody against various target antigens, and precisely detect the glycoprotein biomarker with the produced glycosylated antibody to precisely diagnose the disease.

도 1은 렉틴은 피분석물이 존재하지 않더라도 포획 항체에 결합될 수 있음을 나타낸 모식도이다.1 is a schematic diagram showing that lectins can bind to capture antibodies even when no analyte is present.

도 2는 적절한 렉틴 및 무당질 항체를 사용하는 면역분석 플랫폼인 ALIQUAT(Aglycosylated antibody-Lectin coupled Immunoassay for the QUAntification of Tumor marker)을 통한 특정 글리코폼(glycoform) 분석 방법을 나타낸 모식도이다.Figure 2 is a schematic diagram showing a specific glycoform (glycoform) analysis method through the lysine and saccharide-free antibody ALIQUAT (Aglycosylated antibody-Lectin coupled Immunoassay for the QUAntification of Tumor marker).

도 3은 IgG2c, IgG2b, IgG1 및 IgG3에 공통적으로 존재하는 N-S-T 서열을 나타낸 그림이다.3 is a diagram showing an N-S-T sequence commonly present in IgG2c, IgG2b, IgG1 and IgG3.

도 4는 ARMS(amplification refractory mutation system) 및 PCR을 사용하여 편집된 돌연변이의 스크리닝 과정을 나타낸 모식도이다.Figure 4 is a schematic diagram showing the screening process of the edited mutations using amplification refractory mutation system (ARMS) and PCR.

도 5는 아데닌 염기 편집 과정 후에 태어난 9개의 pup의 IgG2c 유전자에 대한 생거 서열 분석 결과를 나타낸 그림이다.5 shows Sanger sequence analysis results for IgG2c genes of nine pups born after adenine nucleotide editing.

도 6은 아데닌 염기 편집 과정 후에 태어난 9개의 pup의 IgG2b 유전자에 대한 생거 서열 분석 결과를 나타낸 그림이다.FIG. 6 is a diagram showing Sanger sequence analysis results for IgG2b genes of nine pups born after adenine nucleotide editing.

도 7은 아데닌 염기 편집 과정 후에 태어난 9개 pup의 IgG3 유전자에 대한 생거 서열 분석 결과를 나타낸 그림이다.7 is a diagram showing Sanger sequence analysis results for the IgG3 gene of nine pups born after the adenine base editing process.

도 8은 아데닌 염기 편집에 따라 편집된 IgG2c의 염기서열을 나타낸 그림이다.8 is a diagram showing the nucleotide sequence of the IgG2c edited according to the adenine base edit.

도 9는 아데닌 염기 편집에 따라 편집된 IgG2b의 염기서열을 나타낸 그림이다.9 is a diagram showing the nucleotide sequence of the IgG2b edited according to the adenine base edit.

도 10은 아데닌 염기 편집에 따라 편집된 IgG3의 염기서열을 나타낸 그림이다.10 is a diagram showing the nucleotide sequence of the IgG3 edited according to the adenine base edit.

도 11은 IgG2c 및 IgG3에서 pup(# 11)의 생거 서열 분석 결과를 나타낸 그림이다.11 is a diagram showing the result of Sanger sequence analysis of pup (# 11) in IgG2c and IgG3.

도 12는 intermediate founder를 선택하기위한 IgG의 구조 분석 결과를 나타낸 그림이다. (a) 야생형 IgG 단백질 구조는 Asn 잔기에 N- 글리코실화된 N-S-T의 보존된 모티프를 나타낸다. (b) N-글리코실화가 없는 돌연변이 D-S-T 및 G-S-T 항체의 가상 IgG2 구조를 나타내며, G-S-T 모티프는 β-샌드위치 폴드의 구조적 변형을 초래하는 것으로 나타난다.12 is a diagram showing a structure analysis result of IgG for selecting an intermediate founder. (a) Wild type IgG protein structure shows the conserved motif of N-glycosylated N-S-T at Asn residues. (b) shows imaginary IgG2 structures of mutant D-S-T and G-S-T antibodies without N-glycosylation, and the G-S-T motif appears to result in structural modification of β-sandwich folds.

도 13은 아데닌 염기 편집에 따라 편집된 IgG1의 염기서열을 나타낸 그림이다.Figure 13 shows the nucleotide sequence of the IgG1 edited according to the adenine base edit.

도 14는 게놈 편집된 마우스와 야생형 마우스에 있어 생산되는 항체가 동일한 프로파일을 보임을 나타낸 그림이다. 또한 IgG2b 및 IgG3 유전자가 녹아웃된 마우스에서, 상응하는 서브클래스(subclass)의 생산에 결함을 나타낸 그림이다.14 shows the same profile of the antibodies produced in genome edited mice and wild type mice. Also, in mice knocked out of the IgG2b and IgG3 genes, the figure shows a defect in the production of the corresponding subclass.

도 15는 IgG2b 유전자가 녹아웃된 마우스에서, 상응하는 서브클래스(subclass)의 유전자의 결함을 나타낸 그림이다.FIG. 15 is a diagram showing a defect of a gene of a corresponding subclass in a mouse knocked out of an IgG2b gene. FIG.

도 16은 IgG3 유전자가 녹아웃된 마우스에서, 상응하는 서브클래스의 유전자의 결함을 나타낸 그림이다.Figure 16 is a diagram showing the defect of the gene of the corresponding subclass in the mouse knocked out IgG3 gene.

도 17은 간세포 암종(hepatocellular carcinoma)의 암표지자인 인간 AFP를 모델 항원으로 상기 무당질 항체 생산용 동물에 투여하여 각 면역 단계에서 혈청을 채취하여 hAFP에 대한 direct ELISA 분석을 수행한 결과, 시간이 지남에 따라 증가된 반응성을 나타낸 그래프이다.FIG. 17 shows that human AFP, a cancer marker of hepatocellular carcinoma, was administered to the animal-free antibody-producing animal as a model antigen, and serum was collected at each immunization step to perform direct ELISA analysis on hAFP. It is a graph showing increased reactivity over time.

도 18은 hAFP에 대해 특히 특이적인 항체를 생성하는 하이브리도마 클론을 나타낸 그림이다.FIG. 18 is a diagram showing hybridoma clones producing antibodies specifically specific for hAFP.

도 19는 1E5, 2A2 및 3A5 클론의 IgG1 서브클래스 및 카파(kappa) 경쇄의 단일클론항체 분비를 나타낸 그림이다.Figure 19 is a diagram showing the monoclonal antibody secretion of IgG1 subclass and kappa light chain of 1E5, 2A2 and 3A5 clones.

도 20은 1E5 항체의 중쇄에는 N-글리칸이 없음을 나타낸 그림이다.20 shows no N-glycans in the heavy chain of the 1E5 antibody.

도 21은 1E5, 2A2 및 3A5 클론의 무당질화(aglycosylation)를 나타낸 그림이다.Figure 21 shows aglycosylation of 1E5, 2A2 and 3A5 clones.

도 22는 틀이동 넌센스 돌연변이를 갖는 FUT8 -/- 돌연변이 세포주 클론의 유전자형을 나타낸 그림이다.FIG. 22 shows genotype of FUT8 − / − mutant cell line clones with mutated nonsense mutations.

도 23은 FUT8 -/- HEK293-T 세포에 대한 PhoSL의 결합성이 없음을 나타낸 그림이다.Figure 23 shows the lack of binding of PhoSL to FUT8 -/- HEK293-T cells.

도 24는 AFP의 다른 glycoform을 정량화하기 위하여 항-hAFP 항체를 사용하여 면역 블롯 분석한 결과를 나타낸 그림이다.Figure 24 shows the results of immunoblot analysis using anti-hAFP antibodies to quantify other glycoforms of AFP.

도 25는 FUT8 -/- 세포에서 AFP-L3는 나타나지 않고, 야생형 세포에서 AFP-L3의 생성비율은 99.5%임을 확인한 질량분석 결과를 나타낸 그림이다.FIG. 25 is a diagram showing the results of mass spectrometry confirming that AFP-L3 was not present in FUT8 − / − cells and that the production rate of AFP-L3 was 99.5% in wild type cells.

도 26은 유효성이 확인된 시판 항체와 비교하여 0-20ng/mL AFP의 범위에서 우수한 선형성을 나타내는 무당질 항체에 대한 표준 곡선 분석 결과를 나타낸 그래프이다.FIG. 26 is a graph showing the results of standard curve analysis for a glycosylated antibody showing excellent linearity in the range of 0-20 ng / mL AFP as compared to the commercially available antibody.

도 27은 L3 양성 AFP 샘플에 대한 AAL 및 무당질 항체를 사용한 렉틴 ELISA 분석에 따른 민감성과 선형성이 우수한 표준 곡선을 나타낸 그래프이다.FIG. 27 is a graph showing standard curves excellent in sensitivity and linearity according to lectin ELISA analysis using AAL and a sugar-free antibody for L3-positive AFP samples.

도 28은 AFP-L3 표준 분자를 1.0ng/mL 미만의 AFP 수준을 나타내는 정상 혈청에 스파이크한 경우, 0-100ng/mL의 범위에서 양호한 선형성을 갖는 표준 곡선을 나타낸 그래프이다.FIG. 28 is a graph showing standard curves with good linearity in the range of 0-100 ng / mL when AFP-L3 standard molecules are spiked into normal serum showing AFP levels below 1.0 ng / mL.

도 29는 무당질 기반 렉틴-ELISA hAFP 테스트와 μ-TAS 분석에 따른 AFP 농도에 대한 %AFP-L3 값을 나타낸 그래프이다.FIG. 29 is a graph showing% AFP-L3 values for AFP concentrations following a glycosyl-based lectin-ELISA hAFP test and μ-TAS analysis.

도 30은 열 조건에 대한 무당질 항체의 안정성을 나타낸 그림이다.30 is a diagram showing the stability of the sugar-free antibody against thermal conditions.

도 31은 pH 조건에 대한 무당질 항체의 안정성을 나타낸 그림이다.31 is a diagram showing the stability of the sugar-free antibody to pH conditions.

도 32는 산화 조건에 대한 무당질 항체의 안정성을 나타낸 그림이다.32 is a diagram showing the stability of the sugar-free antibody to the oxidation conditions.

본 발명의 일 양상은 IgG(immunoglobulin G) 유전자를 암호화하는 DNA에 혼성화하는 하나 이상의 gRNA(guide RNA)를 암호화하는 뉴클레오티드 서열; Cas9 단백질을 암호화하는 뉴클레오티드 서열; ABE(adenine base editor)를 암호화하는 뉴클레오티드 서열; 및 상기 뉴클레오티드 서열에 작동가능하게 연결된 프로모터를 포함하는 재조합 발현벡터 또는 상기 재조합 발현벡터로부터 생산된 RNA를 제공한다.One aspect of the invention is a nucleotide sequence encoding one or more gRNA (guide RNA) that hybridizes to DNA encoding an IgG (immunoglobulin G) gene; Nucleotide sequences encoding Cas9 proteins; Nucleotide sequences encoding adenine base editors (ABEs); And it provides a recombinant expression vector or RNA produced from the recombinant expression vector comprising a promoter operably linked to the nucleotide sequence.

본 명세서에서는 아데닌 염기 편집 시스템(adenine base editing system)을 활용하여 세포주 또는 수정란의 IgG 유전자를 특이적으로 변형시키거나, 또는 형질전환 체세포 복제 기법의 적용에 의하여, 인간을 제외한 동물인 대리모의 난관에 수정란을 이식하는 단계를 포함하는 무당질 항체 생산용 동물모델의 제조방법, 무당질 항체를 생산하는 형질전환 동물을 생산하는 방법, 및 형질전환 동물로부터 생산된 무당질 항체의 용도가 제공된다.In the present specification, by using an adenine base editing system, specifically modifying the IgG gene of a cell line or fertilized egg, or by applying a transgenic somatic cloning technique, to the fallopian tubes of surrogate mothers other than humans. Provided are a method of preparing an animal model for producing an antibody free of saccharide, comprising a step of transplanting a fertilized egg, a method of producing a transformed animal producing an saccharide free antibody, and a use of a saccharide antibody produced from a transgenic animal.

본 발명에서 사용되는 용어, " 아데닌 염기 편집 시스템(adenine base editing system)"은 nickase Cas9- hypothetical deoxyadenosine deaminase 융합단백질(adenine base editor; ABE)과 gRNA(guide RNA) 로 구성되는 단일염기교정 유도 시스템으로써, 미생물의 면역체계로 알려진 CRISPR(Clustered Regularly Interspaced Short Palindromic Repeats) 과 hypothetical deoxyadenosine deaminase 시스템을 이용해 원하는 유전자 염기서열 중 아데닌을 DNA의 절단없이 구아닌으로 치환하도록 고안된 게놈 편집 시스템을 말한다.As used herein, the term "adenine base editing system" refers to a single base calibration induction system consisting of a nickase Cas9-hypothetical deoxyadenosine deaminase fusion protein (Adenine base editor (ABE) and gRNA (guide RNA)). CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and hypothetical deoxyadenosine deaminase systems, known as microbial immune systems, are genome editing systems designed to replace adenine in the desired gene sequence with guanine without cutting DNA.

본 발명에서 사용되는 용어, "adenine base editor (ABE)"는 adenine base editing 시스템에서 필수적인 단백질 요소로써, nickase-Cas9 hypothetical deoxyadenosine deaminase 융합단백질이며 gRNA와 복합체를 형성하여 단일염기교정을 유도할 수 있다. 상기 ABE 단백질은 2017년 David R. Liu에 의해 개발된 것일 수 있다.As used herein, the term "adenine base editor (ABE)" is an essential protein element in the adenine base editing system, and is a nickase-Cas9 hypothetical deoxyadenosine deaminase fusion protein that can induce a single base calibration by forming a complex with gRNA. The ABE protein may be developed by David R. Liu in 2017.

본 발명에서 사용되는 용어, "base editor"는 기존의 CRISPR/Cas9 시스템 대비 게놈 DNA에서 더욱 효율적으로 변형을 매개하는 단백질을 말하여, 구체적으로 'G-C to A-T' 혹은 'A-T to G-C' 전환이 가능한 염기 편집 시스템(base editing system)에 사용된다. 본 발명에서는 그 중에서도, 'A-T to G-C' 전환을 유도하는 adenine base editor를 사용하여 IgG 유전자의 변형을 유도하였다.As used herein, the term "base editor" refers to a protein that mediates modifications in genomic DNA more efficiently than the existing CRISPR / Cas9 system, and specifically converts 'GC to AT' or 'AT to GC'. Used for base editing system. In the present invention, among others, modification of the IgG gene was induced using an adenine base editor that induces 'A-T to G-C' conversion.

본 발명에서 사용되는 용어, "gRNA"는 표적 DNA에 상보적으로 결합할 수 있는 염기서열을 포함하는 RNA로, gRNA는 Cas9 단백질 혹은 adenine base editor내의 nickase-Cas9 부분과 복합체를 형성할 수 있고, Cas9 단백질 혹은 adenine base editor 단백질을 표적 DNA에 가져올 수 있는 단일 사슬 RNA를 말한다.As used herein, the term "gRNA" refers to an RNA including a base sequence capable of complementarily binding to a target DNA. The gRNA may be complexed with a Cas9 protein or a nickase-Cas9 moiety in an adenine base editor. It is a single-chain RNA that can bring Cas9 protein or adenine base editor protein into target DNA.

본 발명의 재조합 발현벡터 또는 RNA를 이용하여 수정란 또는 세포를 형질전환하면 세포 내에 gRNA 단편을 전달할 수 있고, 전달된 gRNA 단편은 IgG 유전자를 인식할 수 있다. 따라서, 재조합 발현벡터 또는 RNA를 이용하여 수정란 또는 세포를 형질전환하면 세포 내에 gRNA를 전달할 수 있고, 전달된 gRNA는 adenine base editor 또는 Cas9 단백질 복합체가 인식할 수 있는 구조를 형성하는 역할을 할 수 있다.Transformation of the fertilized egg or cell using the recombinant expression vector or RNA of the present invention can deliver the gRNA fragment in the cell, and the delivered gRNA fragment can recognize the IgG gene. Thus, transforming the fertilized egg or cell using a recombinant expression vector or RNA can deliver the gRNA in the cell, and the delivered gRNA can serve to form a structure that can be recognized by the adenine base editor or Cas9 protein complex. .

본 발명에서 사용되는 용어, "변형"은 염기서열 중 특정 아미노산을 코딩하는 서열을 다른 아미노산을 코딩하는 서열로 변환하는 것을 말한다.As used herein, the term “modification” refers to converting a sequence encoding a specific amino acid in a nucleotide sequence into a sequence encoding another amino acid.

본 발명에서 사용되는 용어, "재조합 발현벡터"는 목적한 코딩 서열과, 특정 숙주 생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 진핵세포에서 이용 가능한 프로모터, 인핸서, 종결신호 및 폴리아데닐레이션 신호는 공지되어 있다.As used herein, the term “recombinant expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

본 발명에서 사용되는 용어, "작동가능하게 연결된"은 유전자 발현 조절 서열과 다른 뉴클레오티드 서열사이의 기능적인 결합을 의미한다. 상기 유전자 발현 조절 서열은 복제원점(replication origin), 프로모터 및 전사 종결 서열(terminator) 등으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다. 전사 종결 서열은 폴리아데닐화 서열(pA)일 수 있으며, 복제 원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점 또는 BBV 복제원점 등일 수 있으나, 이에 한정되는 것은 아니다.As used herein, the term “operably linked” means a functional bond between a gene expression control sequence and another nucleotide sequence. The gene expression control sequence may be at least one selected from the group consisting of a replication origin, a promoter, a transcription terminator, and the like. The transcription termination sequence may be a polyadenylation sequence (pA), and the origin of replication may be f1 origin, SV40 origin, pMB1 origin, adeno origin, AAV origin or BBV origin, but is not limited thereto. .

본 발명에서 사용되는 용어, "프로모터"는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며, 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다.As used herein, the term “promoter” refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.

본 발명의 일 구체예에 따른 프로모터는 특정 유전자의 전사 개시를 조절하는 전사 조절 서열 중 하나로, 약 100bp 내지 약 2500bp 길이의 폴리뉴클레오티드 단편일 수 있다. 프로모터는 세포, 예컨대, 진핵 세포(예컨대, 식물 세포, 또는 동물 세포(예를 들어, 인간, 마우스 등의 포유류 세포 등) 등)에서 전사 개시를 조절할 수 있으면, 제한 없이 사용 가능하다. 예를 들어, 프로모터는 CMV 프로모터(cytomegalovirus promoter(예를 들어, 인간 또는 마우스 CMV immediate-early 프로모터), U6 프로모터, EF1-alpha(elongation factor 1-a) 프로모터, EF1-alpha short(EFS) 프로모터, SV40 프로모터, 아데노바이러스 프로모터(major late promoter), pL λ 프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터, 백시니아 바이러스 7.5K 프로모터, HSV의 tk 프로모터, SV40E1 프로모터, 호흡기 세포융합 바이러스(Respiratory syncytial virus; RSV) 프로모터, 메탈로티오닌 프로모터(metallothionin promoter), β-액틴 프로모터, 유비퀴틴 C 프로모터, 인간 IL-2(human interleukin-2) 유전자 프로모터, 인간 림포톡신(human lymphotoxin) 유전자 프로모터 및 인간 GM-CSF(human granulocyte-macrophage colony stimulating factor) 유전자 프로모터로 이루어진 군으로부터 선택되는 것일 수 있으나, 이에 한정되는 것은 아니다. The promoter according to one embodiment of the present invention is one of transcriptional regulatory sequences that regulate transcription initiation of a particular gene, and may be a polynucleotide fragment of about 100bp to about 2500bp in length. Promoters can be used without limitation as long as they can regulate transcriptional initiation in cells, such as eukaryotic cells (eg, plant cells, or animal cells (eg, mammalian cells such as humans, mice, etc.)). For example, the promoter may be a CMV promoter (e.g., a human or mouse CMV immediate-early promoter), a U6 promoter, an elongation factor 1-a (EF1-alpha) promoter, an EF1-alpha short (EFS) promoter, SV40 promoter, adenovirus promoter, pL λ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, vaccinia virus 7.5K promoter, tk promoter of HSV, SV40E1 promoter, Respiratory syncytial virus virus (RSV) promoter, metallothionin promoter, β-actin promoter, ubiquitin C promoter, human interleukin-2 gene promoter, human lymphotoxin gene promoter and human GM -CSF (human granulocyte-macrophage colony stimulating factor) gene promoter may be selected from the group consisting of, but is not limited thereto It is not.

본 발명의 일 구체예에 따른 재조합 발현벡터는 플라스미드 벡터, 코즈미드 벡터 및 박테리오파아지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스 벡터와 같은 바이러스 벡터로 이루어진 군으로부터 선택되는 것일 수 있다. 재조합 발현벡터로 사용될 수 있는 벡터는 당업계에서 사용되는 플라스미드(예를 들어, pcDNA 시리즈, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈, pUC19 등), 파지(예를 들어, λgt4λB, λ-Charon, λΔz1, M13 등) 또는 바이러스 벡터(예를 들어, 아데노-연관 바이러스(AAV) 벡터 등) 등을 기본으로 하여 제작될 수 있으나, 이에 한정되는 것은 아니다.Recombinant expression vectors according to one embodiment of the invention may be selected from the group consisting of viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retrovirus vectors and adeno-associated virus vectors. Vectors that can be used as recombinant expression vectors include plasmids used in the art (eg, pcDNA series, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1). , pHV14, pGEX series, pET series, pUC19, etc., phage (e.g., λgt4λB, λ-Charon, λΔz1, M13, etc.) or viral vectors (e.g., adeno-associated virus (AAV) vectors, etc.) It may be produced as a basis, but is not limited thereto.

본 발명의 재조합 발현벡터는 하나 이상의 선택성 마커를 더 포함할 수 있다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질주입된 세포를 비형질주입 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 예를 들어, 글리포세이트(glyphosate), 글루포시네이트암모늄(glufosinate ammonium) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 암피실린(ampicillin), 카나마이신(kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자일 수 있으나, 이에 한정되는 것은 아니다.The recombinant expression vector of the present invention may further comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, which corresponds to all genes that can distinguish transfected cells from non-transfected cells. For example, herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, ampicillin, kanamycin, G418, bleomycin It may be, but is not limited to, antibiotic resistance genes such as hygromycin and chloramphenicol.

본 발명의 재조합 발현벡터의 제작은 당해 기술 분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용하여 수행될 수 있다.Construction of the recombinant expression vector of the present invention can be prepared using genetic recombination techniques well known in the art, site-specific DNA cleavage and ligation can be carried out using enzymes generally known in the art. have.

본 발명의 재조합 발현벡터로부터 생산한 “RNA”는 상기 재조합 발현벡터를 주형으로 시험관 내에서 합성된 mRNA를 말한다.“RNA” produced from the recombinant expression vector of the present invention refers to mRNA synthesized in vitro using the recombinant expression vector as a template.

본 발명의 일 구체예에 따르면, 상기 IgG는 IgG1, IgG2a, IgG2b, IgG2c 및 IgG3으로 이루어진 군으로부터 선택되는 하나 이상의 IgG일 수 있다.According to one embodiment of the invention, the IgG may be one or more IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.

마우스의 IgG 유전자, 구체적으로 IgG1, IgG2a, IgG2b, IgG2c 및/또는 IgG3의 변형에 의하여 무당질 항체가 마우스로부터 생산이 가능하며, 바람직하게는 IgG1, IgG2b, IgG2c 및 IgG3이 모두 변형되는 것이 바람직하다. 또한, 이와 같이 변형된 IgG 유전자를 마우스의 반복적인 역교배(back cross)에 의하여 고정시킴으로써, 무당질 항체 생산용 마우스 계통의 확립이 가능하다.By modifying the IgG genes of the mouse, specifically IgG1, IgG2a, IgG2b, IgG2c and / or IgG3, a sugar-free antibody can be produced from the mouse. Preferably, all of the IgG1, IgG2b, IgG2c and IgG3 are modified. . In addition, by fixing the IgG gene thus modified by repetitive back cross of the mouse, it is possible to establish a mouse strain for the production of a saccharide-free antibody.

본 발명의 일 구체예에 따르면, 상기 gRNA는 서열번호 2 내지 5로 이루어진 군으로부터 선택되는 어느 하나의 서열에 상보적인 뉴클레오티드 서열을 포함할 수 있다.According to one embodiment of the invention, the gRNA may comprise a nucleotide sequence complementary to any one sequence selected from the group consisting of SEQ ID NOs: 2 to 5.

본 발명의 다른 양상은 상기 재조합 발현 벡터 또는 RNA가 도입된 무당질 항체(aglycosylated antibody) 생산용 동물모델의 제작용 형질전환 세포주 또는 수정란을 제공한다.Another aspect of the present invention provides a transformed cell line or fertilized egg for the production of an animal model for the production of aglycosylated antibody into which the recombinant expression vector or RNA is introduced.

본 발명의 일 구체예에 따른 재조합 발현 벡터 또는 RNA가 도입된 형질전환 수정란을 제조하기 위하여, 야생형 C57BL/6 마우스를 교배하여 수정란은 획득하였으나, 이에 한정되는 것은 아니다. 핵산 분자를 수정란 또는 배아에 도입하는 당 분야에서 공지된 방법을 사용할 수 있으며, 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 예를 들어, 전기천공법(electroporation), 미세주입법(microinjection) 등이 포함될 수 있으나, 이에 한정되는 것은 아니다.In order to prepare a transgenic fertilized egg into which a recombinant expression vector or RNA is introduced according to an embodiment of the present invention, fertilized eggs were obtained by crossing wild-type C57BL / 6 mice, but are not limited thereto. Methods known in the art for introducing nucleic acid molecules into fertilized eggs or embryos can be used and can be carried out by selecting suitable standard techniques as are known in the art. Such a method may include, but is not limited to, for example, electroporation, microinjection, and the like.

본 발명의 일 구체예에 따른 재조합 발현 벡터 또는 RNA가 도입된 형질전환 세포주를 제조하기 위하여, 핵산 분자를 유기체, 세포, 조직 또는 기관에 도입하는 당 분야에서 공지된 방법을 사용할 수 있으며, 당 분야에서 공지된 바와 같이 숙주 세포에 따라 적합한 표준 기술을 선택하여 수행할 수 있다. 이런 방법에는 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO 4) 침전, 염화칼슘(CaCl 2) 침전, 미세주입법(microinjection), 폴리에틸렌글리콜(PEG)법, DEAE-덱스트란법, 양이온성 리포좀법, 및 초산 리튬-DMSO법 등이 포함될 수 있으나, 이에 한정되는 것은 아니다.In order to prepare a transformed cell line into which a recombinant expression vector or RNA is introduced according to an embodiment of the present invention, a method known in the art may be used to introduce a nucleic acid molecule into an organism, cell, tissue or organ. As known in the art, a suitable standard technique can be selected and performed according to the host cell. Such methods include, for example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic Liposome method, and lithium acetate-DMSO method and the like may be included, but is not limited thereto.

형질전환 세포주로 사용될 세포의 종류는 동물세포 또는 동물세포 유래의 세포일 수 있고, 바람직하게는 포유류, 바람직하게는 마우스, 토끼 및 염소 등 항체생산에 사용되는 동물 또는 이들 동물 유래의 체세포 또는 수정란 및 배아 일 수 있고, 가장 바람직하게는 마우스 또는 마우스 유래의 체세포 또는 수정란 및 배아 일 수 있다. 형질전환 세포주로 마우스 유래의 체세포를 사용할 경우, 출생 직후 마우스가 사망하는 문제를 개선할 수 있다.The type of cell to be used as a transformed cell line may be an animal cell or a cell derived from an animal cell, preferably an animal used for producing an antibody such as a mammal, preferably a mouse, a rabbit or a goat, or a somatic cell or fertilized egg derived from these animals, and It may be an embryo, most preferably a mouse or somatic cells or fertilized eggs and embryos derived from a mouse. Using somatic cells derived from mice as a transgenic cell line can improve the problem of mouse death shortly after birth.

본 발명의 또 다른 양상은 상기 수정란을 인간을 제외한 동물인 대리모의 난관에 이식하는 단계를 포함하는 무당질 항체 생산용 동물모델의 제조방법을 제공한다.Another aspect of the present invention provides a method for producing an animal model for the production of a saccharide-free antibody comprising the step of implanting the fertilized egg into the fallopian tube of the surrogate mother, except for humans.

상기 무당질 항체 생산용 동물모델의 제조방법은 체세포 핵이식(SCNT; somatic cell nuclear transfer)에 의한 것일 수 있다. "체세포 핵이식"은 생식과정에서 일반적으로 이루어지는 감수분열 및 반수 염색체 보유 생식세포를 경유하지 않고도 자손을 탄생시킬 수 있는 유전자 조작기술로써, 성체가 가진 배수체 보유 체세포를 핵이 제거된 난자에 이식하여 수정란을 생산하고 상기 수정란을 생체 내로 이식하여 새로운 개체를 발생시키는 방법이다.The production method of the animal model for the production of glycoside-free antibodies may be by somatic cell nuclear transfer (SCNT). "Somatic cell nuclear transfer" is a genetic manipulation technique that allows birth of progeny without passing through meiosis and hemichromosomal-bearing germ cells, which are commonly found in the reproductive process. It is a method of producing a fertilized egg and transplanting the fertilized egg in vivo to generate a new individual.

본 발명에서 사용되는 용어, "핵이식란"은 핵 공여세포가 도입 또는 융합된 난자를 말하며, "융합"은 핵 공여세포와 난자의 지질막 부분의 결합을 의미한다. 예를 들어, 지질막은 세포의 플라스마막 또는 핵막일 수 있다. 융합은 핵 공여 세포와 난자가 서로 인접하게 위치해 있는 경우 또는 핵 공여세포가 수핵 난자의 주란강(perivitelline space) 내에 위치해 있는 경우에 전기적 자극을 가함으로써 일어날 수 있다. 상기 형질전환 세포주는 핵 공여 세포로써, 핵 수용체인 난자로 핵을 전달하는 세포 또는 세포의 핵을 말한다. 난자는 바람직하게는 제2차 감수분열 중기까지 도달한 성숙난자를 말하며, 바람직하게는 마우스의 난자일 수 있다.As used herein, the term "nuclear transplant" refers to an egg into which a nuclear donor cell is introduced or fused, and "fusion" refers to the binding of a nuclear donor cell to a lipid membrane portion of an egg. For example, the lipid membrane can be a plasma membrane or nuclear membrane of a cell. Fusion can occur by applying electrical stimulation when the nuclear donor cell and the egg are located adjacent to each other or when the nuclear donor cell is located in the perivitelline space of the nucleus pulposus egg. The transformed cell line is a nuclear donor cell, and refers to a cell or a cell nucleus that delivers a nucleus to an egg, which is a nuclear receptor. The egg preferably refers to a mature egg that has reached the second meiosis, and may preferably be an egg of a mouse.

본 발명의 일 구체예에 따르면, 상기 동물은 토끼, 염소 또는 마우스(mouse)일 수 있으나, 이에 한정하지는 않는다.According to one embodiment of the invention, the animal may be a rabbit, goat or mouse (mouse), but is not limited thereto.

마우스는 이미 각종 질환의 병리학적 기전과 치료를 위한 연구에 이용되고 있으며, 특히 오랫동안 경제 동물로 가치가 인정되어 다른 중/대 동물을 질환모델로 사용할 때보다 윤리적인 문제점을 피해갈 수 있으며, 안정적인 사육 시스템이 구축되어 있어 실험동물 모델 개발시 유지 및 관리가 용이한 장점이 있다. 또한, 토끼 및 염소 등은 이미 항체 생산에 다양하게 활용되고 있어, 본 발명의 무당질 항체 생산에 용이하게 활용될 수 있다. 항체를 생산할 수 있는 닭, 말 등 기타 동물들도 활용될 수 있다.Mice have already been used for the study of pathological mechanisms and treatments of various diseases. Especially, since mice have been recognized as economic animals for a long time, they can avoid ethical problems than other middle and large animals as disease models, and are stable. Because the breeding system is built, it is easy to maintain and manage when developing the experimental animal model. In addition, rabbits and goats have already been utilized in a variety of antibodies production, it can be easily utilized in the production of the sugar-free antibody of the present invention. Chickens, horses and other animals that can produce antibodies can also be used.

본 발명의 일 구체예에 따르면, 상기 무당질 항체의 생산은 IgG1, IgG2a, IgG2b, IgG2c 및 IgG3으로 이루어진 군으로부터 선택되는 하나 이상의 IgG의 변형에 의한 것일 수 있다.According to one embodiment of the present invention, the production of the sugar-free antibody may be by modification of one or more IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.

IgG 유전자를 구성하는 염기 중 일부의 치환에 의한 IgG의 변형에 의하여, 무당질 항체를 생산하는 동물모델의 제조가 가능하다.By modifying IgG by substitution of some of the bases constituting the IgG gene, it is possible to prepare an animal model for producing a glycoside-free antibody.

본 발명의 일 구체예에 따르면, 상기 변형은 서열번호 2에 해당하는 서열이 서열번호 40의 서열로 치환; 서열번호 3에 해당하는 서열이 서열번호 37의 서열로 치환; 서열번호 4에 해당하는 서열이 서열번호 38의 서열로 치환; 및 서열번호 5에 해당하는 서열이 서열번호 39의 서열로 치환으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것일 수 있다.According to an embodiment of the present invention, the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40; The sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37; The sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38; And the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.

본 발명의 또 다른 양상은 IgG(immunoglobulin G) 유전자가 변형된 무당질 항체 생산용 동물모델을 제공한다.Another aspect of the present invention provides an animal model for the production of a glycosylated antibody in which an IgG (immunoglobulin G) gene is modified.

본 발명의 무당질 항체 생산용 동물모델에 있어서, 전술한 내용과 중복되는 부분은 전술한 의미와 동일한 의미로 사용될 수 있다.In the animal model for producing an antibody of the present invention, a portion overlapping with the above description may be used in the same meaning as the above-described meaning.

본 발명의 일 구체예에 따르면, 상기 변형은 IgG1 중쇄의 아미노산 서열에서 N-S-T 서열 중 하나 이상의 아미노산이 다른 아미노산으로 치환; IgG2b 중쇄의 아미노산 서열에서 N-S-T 서열 중 하나 이상의 아미노산이 다른 아미노산으로 치환; IgG2c 중쇄의 아미노산 서열에서 N-S-T 서열 중 하나 이상의 아미노산이 다른 아미노산으로 치환; 및 IgG3 중쇄의 아미노산 서열에서 N-S-T 서열 중 하나 이상의 아미노산이 다른 아미노산으로 치환으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것일 수 있다.According to one embodiment of the invention, the modification comprises the substitution of one or more amino acids of the N-S-T sequence in the amino acid sequence of the IgG1 heavy chain with another amino acid; In the amino acid sequence of an IgG2b heavy chain one or more amino acids of the N-S-T sequence are replaced with another amino acid; One or more amino acids of the N-S-T sequence in the amino acid sequence of an IgG2c heavy chain are replaced with another amino acid; And one or more amino acids in the N-S-T sequence in the amino acid sequence of the IgG3 heavy chain may be generated by one or more substitutions selected from the group consisting of substitution with other amino acids.

더욱 바람직하게는, 상기 변형은 IgG1 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환; IgG2b 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환; IgG2c 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환 ; 및 IgG3 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것일 수 있다.More preferably, the modification is amino acid N in the N-S-T sequence in the amino acid sequence of the IgG1 heavy chain is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S; In the amino acid sequence of an IgG2b heavy chain amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S; In the amino acid sequence of the IgG2c heavy chain, amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S; And one or more substitutions selected from the group consisting of amino acid N in the NST sequence in the amino acid sequence of the IgG3 heavy chain is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S It may have occurred.

N-S-T의 D-S-T로의 돌연변이는 D-G-T 또는 G-S-T로의 돌연변이와는 달리 N-글리코실화 아스파라긴 잔기가 면역글로불린 β샌드위치 폴드(fold)의 두 가닥 사이에 노출된 루프에 위치하고 있기 때문에, 대전된 측쇄를 갖더라도, 아스파라긴과 동일한 기하학적 구조를 나타내는 아스파르트산은 글리신(GST)에 비해 잠재적 기하학적인 구조적 불안정성을 피할 수 있으므로 바람직하다.Mutations of NST to DST, unlike mutations to DGT or GST, are asparagine, even though they have charged side chains, because N-glycosylated asparagine residues are located in an exposed loop between two strands of an immunoglobulin β-sandwich fold. Aspartic acid, which exhibits the same geometry as, is preferred since it can avoid potential geometrical structural instability compared to glycine (GST).

본 발명의 일 구체예에 따르면, 상기 N-S-T 서열은 IgG1, IgG2a, IgG2b, IgG2c 및 IgG3로 이루어진 군으로부터 선택되는 어느 하나의 IgG 중쇄의 297번 내지 299번 아미노산 서열일 수 있다.According to one embodiment of the present invention, the N-S-T sequence may be amino acid sequence 297 to 299 of any one of the IgG heavy chain selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3.

본 발명의 일 구체예에 따르면, 상기 변형은 서열번호 2에 해당하는 서열이 서열번호 40의 서열로 치환; 서열번호 3에 해당하는 서열이 서열번호 37의 서열로 치환; 서열번호 4에 해당하는 서열이 서열번호 38의 서열로 치환; 및 서열번호 5에 해당하는 서열이 서열번호 39의 서열로 치환으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것일 수 있다.According to an embodiment of the present invention, the modification includes the substitution of the sequence corresponding to SEQ ID NO: 2 with the sequence of SEQ ID NO: 40; The sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37; The sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38; And the sequence corresponding to SEQ ID NO: 5 may be generated by one or more substitutions selected from the group consisting of substitution with the sequence of SEQ ID NO: 39.

본 발명의 일 구체예에 따르면, 상기 동물은 토끼, 염소 또는 마우스일 수 있으나, 이에 한정하지는 않는다.According to one embodiment of the invention, the animal may be a rabbit, goat or mouse, but is not limited thereto.

본 발명의 또 다른 양상은 상기 동물모델에 진단하고자 하는 항원을 투여하는 단계를 포함하는 항원에 대한 무당질 항체의 생산방법을 제공한다.Another aspect of the present invention provides a method for producing a glycosyl antibody against an antigen comprising administering an antigen to be diagnosed to the animal model.

본 발명의 일 구체예에 따르면, 상기 무당질 항체 생산방법은 항원 투여 후 형질전환 마우스로부터 무당질 항체를 분리 및 정제하는 과정을 포함할 수 있다. 항체의 분리 및 정제는 당해 기술 분야에 알려진 방법, 컬럼을 이용한 분리 또는 단백질 G 아가로스 비드를 이용한 분리 방법 등을 이용할 수 있으나, 이에 한정되는 것은 아니다.According to one embodiment of the present invention, the method for producing a sugar-free antibody may include a step of separating and purifying the sugar-free antibody from the transgenic mouse after antigen administration. Separation and purification of the antibody may be a method known in the art, a separation method using a column or a separation method using protein G agarose beads, and the like, but is not limited thereto.

본 발명의 또 다른 양상은 상기 무당질 항체의 생산방법으로 생산된 무당질 항체를 제공한다.Another aspect of the present invention provides a sugar free antibody produced by the method for producing a sugar free antibody.

본 발명의 방법으로 생산된 무당질 항체는 항체의 중쇄에 당사슬이 부가되지 않은 항체, 즉, 당질화 반응이 일어나지 않은 항체이므로, 당쇄 부분에 의한 교차결합을 배제할 수 있으므로, 당쇄 연구를 위한 다양한 분자생물학적 분석실험법과 질병의 진단에 사용하기 위한 키트 등에 유용하게 활용될 수 있다.Since the sugar-free antibody produced by the method of the present invention is an antibody which does not have an oligosaccharide added to the heavy chain of the antibody, that is, an antibody in which no glycosylation reaction has occurred, cross-linking by the sugar chain portion can be excluded, and thus, a variety of sugar chain researches It can be usefully used for molecular biological assays and kits for diagnosis of diseases.

본 발명의 또 다른 양상은 상기 무당질 항체; 및 당단백질 바이오마커를 포함하는 면역진단키트를 제공한다.Another aspect of the present invention is a sugar-free antibody; And it provides an immunodiagnostic kit comprising a glycoprotein biomarker.

본 발명의 면역진단키트는, 예를 들어, 면역진단용 스트립을 사용하는 것일 수 있다. 상기 스트립은 생물학적 시료가 흡수되는 샘플 패드(sample pad); 상기 생물학적 시료에 존재하는 검사하고자 하는 질병 항원과 특이적으로 결합하는 무당질 항체를 포함하는 접합 패드(conjugation pad); 검사하고자 하는 질병 항원에 특이적으로 결합하는 무당질 항체가 고정되어 있는 검사선(test line) 및 대조군 항체가 고정되어 있는 대조선(control line)을 포함하는 반응막(test membrane); 및 상기 생물학적 시료와 각각의 항체가 반응한 후 남은 잔량의 시료가 흡수되는 흡수 패드(absorption pad)를 포함할 수 있으나, 이에 한정되는 것은 아니다. 또한, 당업계에서 면역진단에 일반적으로 사용되는 시약을 더 포함할 수 있다.The immunodiagnostic kit of the present invention may be, for example, using an immunodiagnostic strip. The strip may include a sample pad to which a biological sample is absorbed; A conjugation pad comprising a sugar-free antibody that specifically binds to the disease antigen to be tested present in the biological sample; A test membrane including a test line in which a sugar-free antibody specifically binding to a disease antigen to be tested is immobilized and a control line in which a control antibody is immobilized; And it may include an absorption pad (absorption pad) that is absorbed the remaining amount of the sample after the reaction of the biological sample and each antibody, but is not limited thereto. In addition, it may further comprise a reagent generally used in the immunodiagnosis in the art.

당단백질(glycoprotein)은 2 내지 6 종류의 단당류와 단백질이 공유결합으로 연결된 복합 단백질을 말하며, 생체 내 거의 모든 세포에 존재한다. 세포 외부로부터 오는 신호를 감지, 인식하고, 화학물질을 운반하는 기능을 하며, 각종 염증 및 질병에 관여하는 것으로 알려져 있다. 따라서, 당단백질을 분석함으로써, 다양한 질병의 진단이 가능하다. Glycoprotein refers to a complex protein in which two to six kinds of monosaccharides and proteins are covalently linked, and are present in almost all cells in vivo. It is known to detect and recognize signals from outside the cell, to transport chemicals, and to be involved in various inflammations and diseases. Thus, by analyzing glycoproteins, diagnosis of various diseases is possible.

본 발명에서 사용되는 용어, "면역진단(immunoassay)"은 특이적으로 반응하는 항원-항체 반응에 기초하여 질병의 감염 여부, 발병 여부, 경과 과정 등을 확인하는 방법을 말하며, 효소면역검정법, 형광면역검정법 등을 포함할 수 있으나, 이에 한정되는 것은 아니다.As used herein, the term "immunoassay" refers to a method for confirming whether a disease is infected, onset, course or the like, based on an antigen-antibody response that specifically reacts, enzyme immunoassay, fluorescence Immunoassay methods, and the like, but are not limited thereto.

본 발명의 일 구체예에 따르면, 상기 당단백질 바이오마커는 렉틴에 의해 검출될 수 있다.According to one embodiment of the invention, the glycoprotein biomarker can be detected by lectin.

본 발명에서 사용되는 용어, "렉틴(lectin)"은 특정 당 분자와 특이적으로 결합하는 단백질을 말하며, 분자진단 분야에서는 단백질에 수식된 당사슬의 확인에 사용되는 것일 수 있다.As used herein, the term "lectin" refers to a protein that specifically binds to a specific sugar molecule, and may be used to identify oligosaccharides modified in a protein in the field of molecular diagnostics.

본 발명의 일 구체예에 따르면, 상기 렉틴은 L4-PHA (Phytohemagglutinin-L4), LCA (lens culinaris agglutinin), DSA (Datura stramonium agglutinin), AAL (Aleuria aurantia agglutinin), 셀렉틴 (Selectin), Con A(Concanavalin-A), WGA (Wheat germ agglutinin), 자칼린 (Jacalin), SNA (Sambucus Nigra agglutinin), 갈렉틴 (galectin)일 수 있으나, 이에 한정되는 것은 아니다. According to one embodiment of the invention, the lectin is L4-PHA (Phytohemagglutinin-L4), LCA (lens culinaris agglutinin), DSA (Datura stramonium agglutinin), AAL (Aleuria aurantia agglutinin), Selectin (Selectin), Con A ( Concanavalin-A), heat germ agglutinin (WGA), jacalin (Jacalin), Sambucus Nigra agglutinin (SNA), galectin (galectin), but is not limited thereto.

본 발명의 일 구체예에 따르면, 상기 당단백질은 AFP-L3일 수 있으나, 특정 질병에서 특이적으로 진단에 유효성이 있는 바이오마커까지 포함할 수 있다.According to one embodiment of the present invention, the glycoprotein may be AFP-L3, but may include biomarkers that are specifically effective for diagnosis in a specific disease.

간암 환자에서는 AFP-L3 수준이 증가하고, 간경변, 난소암 환자에서는 CA-125(mucin 16, MUC16)의 수준이 상승하는 것으로 알려져 있다. 상기 무당질 항체에는 렉틴이 결합할 수 없으므로, 본 발명의 키트를 사용하여, 생물학적 시료에 포함되어 있는 당단백질의 유무 및 양을 정확하게 측정할 수 있다. 구체적으로, 본 발명에서는 본 발명의 무당질 항체 생산용 동물모델로부터 생산된 무당질 항체로 AAL을 사용하여 AFP-L3의 양을 측정함으로써 간암의 신뢰성 있는 진단이 가능함을 구체적으로 확인하였다.AFP-L3 levels are increased in liver cancer patients, and CA-125 (mucin 16, MUC16) levels are known to increase in cirrhosis and ovarian cancer patients. Since the lectin cannot bind to the sugar-free antibody, the kit of the present invention can accurately measure the presence and amount of glycoproteins contained in a biological sample. Specifically, the present invention specifically confirmed that it is possible to reliably diagnose liver cancer by measuring the amount of AFP-L3 using AAL as the sugar-free antibody produced from the animal model for producing the sugar-free antibody of the present invention.

본 발명의 일 구체예에 따르면, 본 발명의 면역진단키트를 사용하여 당단백질을 분석하는 방법은 당업계에 알려진 단백질 분석 방법을 추가적으로 사용할 수 있으며, 예를 들어 웨스턴 블럿(Western blot), ELISA(Enzyme Linked Immunosorbent Assay), 방사선면역분석(otA: badioimmunoassay), 방사 면역 확산법, 전기영동, 면역침전 분석법, FACS 및 단백질 칩 방법 등의 방법을 사용할 수 있으나, 이에 한정되는 것은 아니다.According to one embodiment of the present invention, the method for analyzing glycoprotein using the immunodiagnostic kit of the present invention may additionally use a protein analysis method known in the art, for example, Western blot, ELISA ( Enzyme Linked Immunosorbent Assay (OTA), radioimmunoassay (otA: badioimmunoassay), radioimmunoassay, electrophoresis, immunoprecipitation assay, FACS and protein chip methods may be used, but is not limited thereto.

이하 본 발명을 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to one or more embodiments. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

실시예 1. 무당질 항체 생산 마우스 제작 및 평가 방법Example 1 Preparation and Evaluation Method of Glucose-Free Antibody-producing Mouse

1-1. 동물 준비1-1. Animal preparation

동물의 사용 및 관리 절차는 KRIBB의 동물실험윤리위원회(IACUC)에서 검토 및 승인되었다. 접합자(zygote)는 C57BL/6J 마우스에서 얻었고, ICR 암컷 마우스를 대리모(recipient)로 사용하였다. 유전자 편집된 C57BL/6J 마우스는 Balb/c 마우스와 역교배(back-cross)되었다. 모든 동물은 12 시간의 명암주기로 24℃의 항온 및 40%의 습도의 무균 사육장에서 사육되었다.Animal use and care procedures were reviewed and approved by KRIBB's Animal Experimental Ethics Committee (IACUC). Zygotes were obtained from C57BL / 6J mice, and ICR female mice were used as recipients. Genetically edited C57BL / 6J mice were back-crossed with Balb / c mice. All animals were housed in sterile kennels with a constant temperature of 24 ° C. and a humidity of 40% with a 12-hour contrast cycle.

1-2. ABE(adenine base editor) mRNA 준비1-2. Adenine base editor mRNA preparation

pCMV-ABE7.10(addgene, #102919) 및 xCas9(3.7)-ABE(7.10)(addgene, #108382) 플라스미드 벡터는 Addgene에서 구입하였다. 플라스미드를 AgeI(NEB)로 37℃에서 2시간 동안 분해하여 선형화된 벡터를 PCR 정제 키트(QIAGEN)를 사용하여 정제하였다. 정제된 벡터 1㎍을 mMESSAGE mMACHINE T7 Ultra 키트(Thermo Fisher Scientific)를 사용하여 mRNA 합성을 위한 주형으로 사용하였다. mRNA는 MEGAclear 키트(Thermo Fisher Scientific)를 사용하여 분리하고, 동결튜브 바이알에 소분한 후, 액체질소에 저장하였다. 사용한 ABE의 염기서열은 표 1과 같다.pCMV-ABE7.10 (addgene, # 102919) and xCas9 (3.7) -ABE (7.10) (addgene, # 108382) plasmid vectors were purchased from Addgene. Plasmids were digested with AgeI (NEB) for 2 hours at 37 ° C. and the linearized vector was purified using a PCR purification kit (QIAGEN). 1 μg of the purified vector was used as a template for mRNA synthesis using the mMESSAGE mMACHINE T7 Ultra kit (Thermo Fisher Scientific). mRNA was isolated using a MEGAclear kit (Thermo Fisher Scientific), aliquoted into frozen tube vials and stored in liquid nitrogen. The base sequence of the used ABE is shown in Table 1.

ABE; 서열번호 1ABE; SEQ ID NO: 1 ggaaaatattatccatttgtttactcttaccaacctcggcgctccagccgcattcaagtattttgacacaacgatagatcgcaaacgatacacttctaccaaggaggtgctagacgcgacactgattcaccaatccatcacgggattatatgaaactcggatagatttgtcacagcttgggggtgactctggtggttctcccaagaagaagaggaaagtctaaggaaaatattatccatttgtttactcttaccaacctcggcgctccagccgcattcaagtattttgacacaacgatagatcgcaaacgatacacttctaccaaggaggtgctagacgcgacactgattcaccaatccatcacgggattatatgaaactcggatagatttgtcacagcttgggggtgactgtggtggggttctcacaagaaga

1-3. 미세주입 및 전기천공에 따른 게놈 편집 및 접합체의 이식1-3. Genome Editing and Transplantation of Conjugates Following Microinjection and Electroporation

PMSG 호르몬(5IU, Merck) 주입 후, 48시간 간격으로 C57BL/6J 암컷 마우스(5 주령)의 복강 내로 hCG 호르몬(5IU)을 주입하였다. 암컷 마우스를 9주령의 C57BL/6J 수컷 마우스와 교배시키고, 1세포 접합자를 암컷 마우스의 난관팽대부(ampulla of oviduct)에서 수득하였다. 난구세포(cumulus cell)는 3mg/ml hyaluronidase(Merck)가 함유된 M2 배지에서 배양하여 제거되었다. 실시예 1-2의 표 1의 염기서열을 갖는 ABE mRNA 3 ug/μl, 와 표적 DNA 결합을 위한 sgRNA(Toolgen, 한국) 3ug/μl을 포함하는 혼합물을 LEICA DMIRB 원격조종기(Leica-microsystems)가 장착된 Femtojet 미량주입기(Eppendorf, 독일)를 사용하여 접합자의 세포질에 미량주입하였다.After injection of PMSG hormone (5IU, Merck), hCG hormone (5IU) was injected into the abdominal cavity of C57BL / 6J female mice (5 weeks old) at 48 hour intervals. Female mice were crossed with 9-week-old C57BL / 6J male mice, and one-cell conjugates were obtained from the ampulla of oviduct of female mice. Cumulus cells were removed by culturing in M2 medium containing 3mg / ml hyaluronidase (Merck). A mixture comprising 3 ug / μl of ABE mRNA having the nucleotide sequence of Table 1 of Example 1-2 and 3 ug / μl of sgRNA (Toolgen, Korea) for binding target DNA was prepared by a LEICA DMIRB remote controller (Leica-microsystems). Microinjection was made in the cytoplasm of the conjugates using a fitted Femtojet microinjector (Eppendorf, Germany).

명칭designation CRISPR 표적 염기서열(5'→3')CRISPR target sequence (5 '→ 3') 서열번호SEQ ID NO: Ighg1Ighg1 TCAACAGCACTTTCCGTTC AGTTCAACAGCACTTTCCGTTC AGT 서열번호 2SEQ ID NO: 2 Ighg2bIghg2b TACAACAGTACTATCCGGG TGGTACAACAGTACTATCCGGG TGG 서열번호 3SEQ ID NO: 3 Ighg2cIghg2c TACAACAGTACTCTCCGGG TGGTACAACAGTACTCTCCGGG TGG 서열번호 4SEQ ID NO: 4 Ighg3Ighg3 TACAACAGTACCTTCCGAG TGGTACAACAGTACCTTCCGAG TGG 서열번호 5SEQ ID NO: 5

한편, 게놈 편집을 위하여, sgRNA 500ng/μl 및 실시예 1-2에서 준비한 ABE mRNA 400ng/μl를 opti-MEM(Gibco)에 용해하여 전기천공(electroporation)용 혼합물을 제조하였다. 접합자를 전기천공용 혼합물에 현탁시키고, 제조사의 프로토콜에 따라 NEPA 21 전기천공기(NEPA GENE)를 사용하여 전기천공하였다.Meanwhile, for genome editing, 500ng / μl of sgRNA and 400ng / μl of ABE mRNA prepared in Example 1-2 were dissolved in opti-MEM (Gibco) to prepare a mixture for electroporation. The conjugate was suspended in the electroporation mixture and electroporated using a NEPA 21 electroporator (NEPA GENE) according to the manufacturer's protocol.

미량주입 및 전기천공 후, 5% CO 2 보충된 37℃의 배양기에서 접합자를 KSOM+AA 배지(Millipore)에서 2세포 단계까지 배양한 후, 생존 가능한 세포를 위임신(pseudo-pregnant) 대리모 마우스의 난관에 이식하였다.After microinjection and electroporation, the incubator was incubated in KSOM + AA medium (Millipore) up to 2 cell stages in a 37 ° C. incubator supplemented with 5% CO 2 , followed by surviving cells of pseudo-pregnant surrogate mice. Implanted in the fallopian tube.

1-4. 유전형 분석1-4. Genotyping

게놈 DNA를 분리하기 위하여 1주령의 pup에서 발가락을 절단하였다. Toes were cut from a 1 week old pup to isolate genomic DNA.

프라이머primer 프라이머 염기서열(5'→3')Primer base sequence (5 '→ 3') PCR 산물 크기(bp)PCR product size (bp) 서열번호SEQ ID NO: ControlControl AA GG Ighg 1_ARMS_outer_FIghg 1_ARMS_outer_F TCCCAGAAGTATCATCTGTCTCCCAGAAGTATCATCTGTC 321321 203203 147147 서열번호 6SEQ ID NO: 6 Ighg 1_ABE+G-ARMS F_14+GIghg 1_ABE + G-ARMS F_14 + G GGAGGAGCAGATCAGGGAGGAGCAGATCAG 서열번호 7SEQ ID NO: 7 Ighg 1_ABE-A-ARMS R_15Ighg 1_ABE-A-ARMS R_15 AACGGAAAGTGCTGTAACGGAAAGTGCTGT 서열번호 8SEQ ID NO: 8 Ighg 1_ARMS_outer_RIghg 1_ARMS_outer_R CTTTGGTTTTGGAGATGGTTCTTTGGTTTTGGAGATGGTT 서열번호 9SEQ ID NO: 9 Ighg 2b_ARMS_outer FIghg 2b_ARMS_outer F CTAACCTCGAGGGTGGCTAACCTCGAGGGTGG 476476 209209 296296 서열번호 10SEQ ID NO: 10 Ighg 2b_ABE+G-ARMS R_14+G Ighg 2b_ABE + G-ARMS R_14 + G ATAGAGAGGATTACGATAGAGAGGATTACG 서열번호 11SEQ ID NO: 11 Ighg 2b_ABE-A-ARMS R 15Ighg 2b_ABE-A-ARMS R 15 CCGGATAGTACTGTTCCGGATAGTACTGTT 서열번호 12SEQ ID NO: 12 Ighg 2b_ARMS_outer_RIghg 2b_ARMS_outer_R GGCGGCAAGATGTATACGGCGGCAAGATGTATAC 서열번호 13SEQ ID NO: 13 Ighg 2c_ARMS_outer FIghg 2c_ARMS_outer F CATGCGCAGGTAAGTCCATGCGCAGGTAAGTC 403403 330330 102102 서열번호 14SEQ ID NO: 14 Ighg 2c_ABE+G-ARMS F _14+GIghg 2c_ABE + G-ARMS F _14 + G ATAGAGAGGATTACGATAGAGAGGATTACG 서열번호 15SEQ ID NO: 15 Ighg 2c_ABE-A-ARMS R_15Ighg 2c_ABE-A-ARMS R_15 CCGGAGAGTACTGTTCCGGAGAGTACTGTT 서열번호 16SEQ ID NO: 16 Ighg 2c_ARMS_outer_RIghg 2c_ARMS_outer_R TGTTGTTGACCTTGCATTTGTGTTGTTGACCTTGCATTTG 서열번호 17SEQ ID NO: 17 Ighg 3_ARMS_outer_FIghg 3_ARMS_outer_F CTGGTAACATCTTGGGTGGACTGGTAACATCTTGGGTGGA 506506 212212 323323 서열번호 18SEQ ID NO: 18 Ighg 3_ABE+G-ARMS F_14+GIghg 3_ABE + G-ARMS F_14 + G GTGAAGCTCAGTACGGTGAAGCTCAGTACG 서열번호 19SEQ ID NO: 19 Ighg 3_ABE-A-R_15Ighg 3_ABE-A-R_15 TCGGAAGGTACTGTTTCGGAAGGTACTGTT 서열번호 20SEQ ID NO: 20 Ighg 3_ARMS_outer_RIghg 3_ARMS_outer_R TTCTTCTTGGACATTTGTTTTCTTCTTGGACATTTGTT 서열번호 21SEQ ID NO: 21

단일염기교정 확인을 위하여, H-Taq(Biofact)를 사용한 ARMS(amplification refractory mutation system)에 의해 유전자형(genotyping)의 사전 선별을 표 3의 프라이머를 사용하여 수행하고, 표적 부위에서 구아닌 밴드만을 갖는 샘플을 생거 시퀀싱 분석하였다. 최종 돌연변이는 표적 유전자좌를 Pfu 및 특이적 프라이머를 사용하여 PCR 증폭시켰다(표 4). PCR 산물의 생거 시퀀싱 분석 방법으로 확인하였다.For single nucleotide calibration, pre-selection of genotyping was carried out using the primers of Table 3 by an amplification refractory mutation system (ARMS) using H-Taq (Biofact) and a sample having only guanine bands at the target site. Sanger sequencing analysis. The final mutation was PCR amplified the target locus using Pfu and specific primers (Table 4). The PCR product was confirmed by Sanger sequencing analysis method.

프라이머primer 프라이머 염기서열(5'→3')Primer base sequence (5 '→ 3') 서열번호SEQ ID NO: IgG subclass_Ighg1IgG subclass_Ighg1 forwardforward GCAGCACCAAGGTGGACAAGGCAGCACCAAGGTGGACAAG 서열번호 22SEQ ID NO: 22 reversereverse GTGCTGGGTGTGGCAGTGTAGTGCTGGGTGTGGCAGTGTA 서열번호 23SEQ ID NO: 23 IgG subclass_Ighg2bIgG subclass_Ighg2b forwardforward CTCCTAACTCCGAGGGTGGACTCCTAACTCCGAGGGTGGA 서열번호 24SEQ ID NO: 24 reversereverse GAGATGGTTCTTCCGATGGGGAGATGGTTCTTCCGATGGG 서열번호 25SEQ ID NO: 25 IgG subclass_Ighg2cIgG subclass_Ighg2c forwardforward ACCATCCGTCTTCATCTTCCACCATCCGTCTTCATCTTCC 서열번호 26SEQ ID NO: 26 reversereverse TGTTGTTGACCTTGCATTTGTGTTGTTGACCTTGCATTTG 서열번호 27SEQ ID NO: 27 IgG subclass_Ighg3IgG subclass_Ighg3 forwardforward CTGGTAACATCTTGGGTGGACTGGTAACATCTTGGGTGGA 서열번호 28SEQ ID NO: 28 reversereverse TGAGATGGTTCTCTCGATGGTGAGATGGTTCTCTCGATGG 서열번호 29SEQ ID NO: 29 Fut8_Exon 9Fut8_Exon 9 forwardforward ACCAGTGTCAATGCGAGCATACCAGTGTCAATGCGAGCAT 서열번호 30SEQ ID NO: 30 reversereverse TTTCAAGGGCCAGGAAGACTTTTCAAGGGCCAGGAAGACT 서열번호 31SEQ ID NO: 31 Fut8_Exon 11Fut8_Exon 11 forwardforward GTGAAAGGTGGGAGGAGGGTGTGAAAGGTGGGAGGAGGGT 서열번호 32SEQ ID NO: 32 reversereverse TCCAGATGATTCTCATGCATGCTTCCAGATGATTCTCATGCATGCT 서열번호 33SEQ ID NO: 33

1-5. 하이브리도마 세포 제작1-5. Hybridoma Cell Fabrication

TiterMax Gold 보조제(Merck) 100㎕에 인간 AFP(Mybiosource) 50㎍을 용해시켜 항원성 용액(antigenic solution)을 제조하고, 게놈 편집된 마우스(6주령)의 발바닥에 1주 간격으로 4회 주입하였다. 최종 주입 후, 슬와 림프절(popliteal lymph node)을 해부하여 B 세포를 수득한 후, 기존의 방법에 따라 FO 골수종(myeloma) 세포와 융합시켰다. 단일 융합 세포를 배양 접시에 넣고, 20% FBS, 1xHAT(100uM hypoxanthine, 0.4uM aminopterin 및 16uM thymidine)(Merck), 1x항생제-항균 용액(100units/ml 페니실린, 100ug/ml streptomycin sulfate 및 0.25μg/ml amphotericin B) (Welgene, Korea)를 첨가한 채 2주 동안 배양하였다. hAFP에 대한 항체를 생산하는 양성 클론을 indirect ELISA 검사를 사용하여 선별하였다. 인간 AFP 용액은 1μg/ml의 농도로 hAFP를 PBS에 용해시켜 제조하였다. 96-웰 플레이트(Thermo Fisher scientific)의 표면을 코팅하기 위해 항원 용액(100㎕)을 사용하였다. 블로킹 후, 배양 배지를 100배 희석하고 코팅된 플레이트의 웰에 첨가한 후 인큐베이션하였다. TBS-Tween20(0.02 %)으로 3회 세척한 후, HRP(Cell Signaling Technology, 희석 비율: 1:2000)가 컨쥬게이트된 항-마우스 2차 항체를 처리하고, TMB-ultra solution(Thermo Fisher Scientific)을 처리하였다. 0.2N H 2SO 4 100㎕를 첨가하여 화학 반응을 정지시킨 후, VERSA max 마이크로플레이트 판독기(Molecular Devices)를 사용하여 450nm에서의 흡광도를 측정하였다. 무당질(aglycosylated) 단일클론항체를 생산하기 위하여, 양성 클론을 무혈청배지(Gibco)에서 배양하였다.Antigenic solution was prepared by dissolving 50 μg of human AFP (Mybiosource) in 100 μl of TiterMax Gold adjuvant (Merck), and injected 4 times at 1 week intervals into the sole of the genome edited mouse (6 weeks old). After the final injection, the popliteal lymph nodes were dissected to obtain B cells and then fused with FO myeloma cells according to conventional methods. Single fusion cells were placed in a petri dish and 20% FBS, 1xHAT (100uM hypoxanthine, 0.4uM aminopterin and 16uM thymidine) (Merck), 1x antibiotic-antibacterial solution (100units / ml penicillin, 100ug / ml streptomycin sulfate and 0.25μg / ml Cultured for 2 weeks with amphotericin B) (Welgene, Korea). Positive clones producing antibodies against hAFP were selected using the indirect ELISA assay. Human AFP solutions were prepared by dissolving hAFP in PBS at a concentration of 1 μg / ml. Antigen solution (100 μl) was used to coat the surface of a 96-well plate (Thermo Fisher scientific). After blocking, the culture medium was diluted 100-fold and added to the wells of the coated plate and incubated. After washing three times with TBS-Tween20 (0.02%), HRP (Cell Signaling Technology, Dilution Ratio: 1: 2000) was treated with the anti-mouse secondary antibody conjugated and TMB-ultra solution (Thermo Fisher Scientific) Was treated. After stopping the chemical reaction by adding 100 μl of 0.2NH 2 SO 4 , absorbance at 450 nm was measured using a VERSA max microplate reader (Molecular Devices). In order to produce aglycosylated monoclonal antibodies, positive clones were cultured in serum-free medium (Gibco).

1-6. 단일클론항체의 생산1-6. Production of Monoclonal Antibodies

실시예 1-5에서 제조한 하이브리도마 세포를 5% CO 2가 보충된 챔버에서 72시간 동안 100RPM으로 교반하면서 무혈청배지(Gibco)에서 배양하였다. 조건 배지(conditioned media)를 수득하고, 13,000g에서 30분간 원심분리하여 세포 파편을 제거하였고, 잔여 파편들을 0.22㎛ 주사기 필터(Millipore)로 여과하여 제거하였다. FPLC 시스템(AKTA 정수기, GE healthcare Life Sciences)을 사용한 HiTrap TM Protein G HPcolumn(GE healthcare Life Sciences)으로 여과액을 정제하였다. PBS(phosphate-buffered saline) 버퍼로 평형을 맞춘 칼럼에 1ml/min의 유속으로 여과액을 통과시키고, 결합 단백질을 3㎖/min의 유속에서 50mM 글리신-HCl(pH 2.5)로 용출시켰다. 용출된 분획을 1M Tris-HCl(pH 8.0)로 중화시킨 후, 단백질 안정화 칵테일 용액(Thermo Fisher Scientific)과 혼합하고, -20℃에서 보관하였다. Hybridoma cells prepared in Example 1-5 were cultured in serum-free medium (Gibco) while stirring at 100 RPM for 72 hours in a chamber supplemented with 5% CO 2 . Conditioned media was obtained, cell debris was removed by centrifugation at 13,000 g for 30 minutes, and the remaining debris was removed by filtration with a 0.22 μm syringe filter (Millipore). The filtrate was purified by HiTrap Protein G HPcolumn (GE healthcare Life Sciences) using an FPLC system (AKTA Water Purifier, GE healthcare Life Sciences). The filtrate was passed through a column equilibrated with PBS (phosphate-buffered saline) buffer at a flow rate of 1 ml / min, and the bound protein was eluted with 50 mM glycine-HCl (pH 2.5) at a flow rate of 3 ml / min. The eluted fractions were neutralized with 1M Tris-HCl, pH 8.0, then mixed with protein stabilized cocktail solution (Thermo Fisher Scientific) and stored at -20 ° C.

1-7. FUT8 녹아웃 세포 제작1-7. FUT8 knockout cell fabrication

혼성화된 올리고뉴클레오티드 쌍을 pSpCas9(BB)-2A-Puro(PX459)(Addgene plasmid #48139) 벡터에 클로닝함으로써 FUT8 표적화 가이드 RNA 구조물(표 5)을 생성하였다. FUT8 targeting guide RNA constructs (Table 5) were generated by cloning hybridized oligonucleotide pairs to pSpCas9 (BB) -2A-Puro (PX459) (Addgene plasmid # 48139) vector.

명칭designation CRISPR 표적 염기서열(5'→3')CRISPR target sequence (5 '→ 3') 서열번호SEQ ID NO: Fut8-e9-sgRNA#1Fut8-e9-sgRNA # 1 TACTACCTCAGTCAGACAGA TACTACCTCAGTCAGACAGA 서열번호 34SEQ ID NO: 34 Fut8-e9-sgRNA#2Fut8-e9-sgRNA # 2 AACCAGTTCTGTCAGATCTT AACCAGTTCTGTCAGATCTT 서열번호 35SEQ ID NO: 35 Fut8-e11-sgRNA#1Fut8-e11-sgRNA # 1 CACCCAGCGAACACTCATCT CACCCAGCGAACACTCATCT 서열번호 36SEQ ID NO: 36

구체적으로, 10ug의 벡터를 50units의 BbsI로 1시간 동안 절단하고, 절단된 벡터를 겔 추출 키트(Solgent)를 사용하여 추출한 후, gRNA 쌍(10pmol)을 선형화된 벡터에 클로닝하였다. 표적 서열은 생거 시퀀싱 분석 방법으로 확인하였다. 벡터 구조물(10μg)을 사용하여 전압 1300V, 펄스 폭 10ms 및 펄스 수 3의 전기천공기(electroporator)(Neon, Invitrogen)를 사용하여 HEK293-T 세포(8×10 5 세포)를 형질전환하였다. 각 웰에 단일 세포를 분주하여 클론을 형성하였으며, 각 클론에 대해 생거 시퀀싱 분석 방법으로 유전자형 분석을 수행하여 FUT8 -/- 클론을 선별하였다.Specifically, 10 ug of vector was cut for 1 hour with 50 units of BbsI, and the cut vector was extracted using a gel extraction kit (Solgent), and gRNA pairs (10 pmol) were cloned into the linearized vector. Target sequences were confirmed by Sanger sequencing analysis method. HEK293-T cells (8 × 10 5 cells) were transformed using an electroporator (Neon, Invitrogen) of voltage 1300 V, pulse width 10 ms and pulse number 3 using a vector construct (10 μg). Single cells were aliquoted into each well to form clones, and FUT8 − / − clones were selected by genotyping for each clone by Sanger sequencing analysis.

1-8. μ-Tas 분석1-8. μ-Tas analysis

자동 분석기(automatic analyzer)(mTAS Wako i30, Wako Pure Chemical Industries, Osaka, Japan)에서 마이크로 칩 모세관 전기영동(microchip capillary electrophoresis) 및 액상 결합 분석(liquid-phase binding assay)을 수행하여 잔류 혈청 검체에서 알파태아단백(alpha-fetoprotein)인 AFP-L3을 측정하였다. AFP에 대해 0.3 내지 2000ng/mL 범위에서 측정하였으며, AFP 농도가 0.3ng/ml를 초과하는 혈청에서 AFP-L3 농도를 계산하였다. 시료의 AFP 농도가 2,000ng/mL 이상인 경우 시료를 제조사의 지침에 따라 기존 결과를 기준으로 수동으로 희석하였다. 모든 검사는 부산대학교 양산 병원에서 수행되었으며, 검사 전 피험체에 대한 어떠한 정보도 제공되지 않았다.Microchip capillary electrophoresis and liquid-phase binding assays were performed on an automatic analyzer (mTAS Wako i30, Wako Pure Chemical Industries, Osaka, Japan) to provide alpha in residual serum samples. Fetal protein (alpha-fetoprotein) AFP-L3 was measured. Measurements ranged from 0.3 to 2000 ng / mL for AFP, and AFP-L3 concentrations were calculated in serum with AFP concentrations greater than 0.3 ng / ml. If the AFP concentration of the sample was more than 2,000 ng / mL, the sample was manually diluted based on existing results according to the manufacturer's instructions. All tests were performed at Yangsan Hospital, Pusan National University, and no information was provided on subjects before the test.

1-9. 면역형광분석1-9. Immunofluorescence

편집된 HEK293-T 세포(2×10 4)를 DEME 배지의 18mm×18mm 커버글라스 상에서 1일 동안 성장시켰다. 세포를 BD cytofix/cytoperm 용액(BD bioscience)으로 12시간 동안 고정하였다. 그 후, 세포를 2시간 동안 실온에서 9ng/ul PhoSL-alexa488의 존재하에 배양하였다. PBS로 3회 세척한 후, 1.5㎍/ml DAPI를 함유하는 Vectashield 봉입제(mounting medium)(VECTOR Laboratories)로 커버글라스를 덮었다. Zeiss LSM510 Meta 현미경(Carl Zeiss MicroImaging)으로 형광을 모니터링하였다.Edited HEK293-T cells (2 × 10 4 ) were grown for 1 day on 18 mm × 18 mm cover glass in DEME medium. Cells were fixed for 12 hours with BD cytofix / cytoperm solution (BD bioscience). Cells were then incubated in the presence of 9 ng / ul PhoSL-alexa488 for 2 hours at room temperature. After washing three times with PBS, the cover glass was covered with a Vectashield mounting medium (VECTOR Laboratories) containing 1.5 μg / ml DAPI. Fluorescence was monitored by a Zeiss LSM510 Meta microscope (Carl Zeiss MicroImaging).

1-10. 샌드위치 렉틴-ELISA1-10. Sandwich Lectin-ELISA

완충액(pH 7.4) 0.1M 중탄산나트륨(sodium-bicarbonate)에 용해된 항-hAFP 마우스 단일클론항체(#ab54745, Abcam) 또는 항-hAFP 무당질 항체 0.5μg으로 ELISA 웰 플레이트를 4℃에서 밤새 코팅하였다. 플레이트를 TBS-0.1% Tween 20으로 2회 세척하고 무단백 블로킹 완충액(Thermo Fisher Scientific) 또는 0.5% 폴리비닐알콜 + 0.1% Tween 20을 사용하여 실온에서 1시간 동안 블록킹하였다. 각각의 웰에 임상 시료 또는 배양 배지(100μl)를 분주하였다. 각각의 웰을 RIPA 버퍼(25mM Tris-HCl 7.6, 150mM NaCl, 1% NP40, 1% sodium deoxycholate, 0.1% SDS)로 5회 이상 세척하고, 다시 TBS-0.1% Tween 20으로 반복하였다. 1 : 2,000으로 희석된 항-hAFP 토끼 다클론항체(# ab8201, Abcam) 또는 1 : 1,000으로 희석된 비오틴-표지된 AAL(aleuria aurantia lectin)(# B-1395, VECTOR Laboratories) 중 하나를 실온에서 1시간 동안 처리하였다. 충분히 세척한 후, 각각 HRP와 컨쥬케이트된 항 토끼 제2항체(Cell Signaling) 또는 스트렙타비딘을 1 : 2,000로 희석하고, 실온에서 1시간 동안 처리하였다. TBS-0.1% Tween 20으로 간단히 세척한 후, TMP 기질 용액(Thermo fisher Scientific) 100㎕를 각 웰에 첨가하고, 2N 황산으로 반응을 정지시킨 후, 450nm에서의 흡광도를 측정하였다.ELISA well plates were coated overnight at 4 ° C. with 0.5 μg of anti-hAFP mouse monoclonal antibody (# ab54745, Abcam) or anti-hAFP glycosylated antibody dissolved in 0.1 M sodium bicarbonate in buffer (pH 7.4). . Plates were washed twice with TBS-0.1% Tween 20 and blocked for 1 hour at room temperature using proteinless blocking buffer (Thermo Fisher Scientific) or 0.5% polyvinylalcohol + 0.1% Tween 20. Each well was dispensed with clinical sample or culture medium (100 μl). Each well was washed 5 or more times with RIPA buffer (25 mM Tris-HCl 7.6, 150 mM NaCl, 1% NP40, 1% sodium deoxycholate, 0.1% SDS) and then repeated with TBS-0.1% Tween 20. Anti-hAFP rabbit polyclonal antibody (# ab8201, Abcam) diluted 1: 2,000 or biotin-labeled aleuria aurantia lectin (A B) diluted to 1,000 (# B-1395, VECTOR Laboratories) at room temperature Treated for 1 hour. After sufficient washing, the anti-rabbit second antibody (Cell Signaling) or streptavidin conjugated with HRP, respectively, was diluted 1: 2,000 and treated at room temperature for 1 hour. After a brief wash with TBS-0.1% Tween 20, 100 μl of TMP substrate solution (Thermo fisher Scientific) was added to each well, the reaction was stopped with 2N sulfuric acid, and the absorbance at 450 nm was measured.

1-11. 안정성 테스트1-11. Stability test

탈글리코실화된(deglycosylated) 항체는 50℃에서 15분 동안 Rapid PNGase F 비-환원형 버퍼에서 PNGase-F(NEB) 100units과 시판중인 항-hAFP 항체(# MIA1305, Thermo fisher Scientific) 10μg을 인큐베이션하여 준비되었다. 시간 의존적 및 온도 의존적 단백질 안정성은 PBS 완충액에서 글리코실화, 탈글리코실화 또는 무당질 항체를 4℃또는 37℃에서 최대 14일 동안 인큐베이션하여 측정하였다. 인큐베이션된 항체를 4-20% Mini-Protein TGX TM 겔(BioRad)에서 전기영동시키고 쿠마시 블루 염색에 의해 시각화하였다. 단백질 안정성은 pH 3.0, 7.0 또는 10.0으로 조정된 0.1M 인산염 버퍼에서 항체를 0-14일 동안 인큐베이션하여 모니터링하였다. 또한, 각 항체를 0-3% H 2O 2를 함유한 PBS 버퍼에서 5시간 동안 37℃ 배양기로 인큐베이션하였다. 항체의 온전성(integrity)은 상기 기재된 ELISA 분석에 의해 측정되었다.Deglycosylated antibodies were incubated at 100 ° C. for 15 minutes by incubating 10 units of commercially available anti-hAFP antibody (# MIA1305, Thermo fisher Scientific) with 100 units of PNGase-F (NEB) in Rapid PNGase F non-reducing buffer. Ready Time dependent and temperature dependent protein stability was determined by incubating glycosylated, deglycosylated, or glycosylated antibodies in PBS buffer at 4 ° C. or 37 ° C. for up to 14 days. Incubated antibodies were electrophoresed on 4-20% Mini-Protein TGX gel (BioRad) and visualized by Coomassie Blue staining. Protein stability was monitored by incubating the antibody for 0-14 days in 0.1M phosphate buffer adjusted to pH 3.0, 7.0 or 10.0. In addition, each antibody was incubated in a 37 ° C. incubator for 5 hours in PBS buffer containing 0-3% H 2 O 2 . Integrity of the antibodies was measured by the ELISA assay described above.

1-12. 통계분석1-12. Statistical analysis

인델(indel) 효율에 대한 통계적 테스트는 two-tailed Student's t-test를 사용하여 Sigma Plot에서 수행되었었으며, p value < 0.05는 유의한 것으로 간주하였다.Statistical tests for indel efficiency were performed in Sigma Plot using a two-tailed Student's t-test, where p value <0.05 was considered significant.

실시예 2. 게놈 편집에 의한 무당질 항체 생산 마우스 확립Example 2. Establishment of Glucose-Free Antibody-producing Mouse by Genome Editing

면역글로블린 G(IgG)는 N-연결된 당단백질로, 일반적인 당단백질과 마찬가지로 글리칸 구조에 이질성(heterogeneity)을 나타낸다. 이와 같은 특성 때문에, 렉틴을 포함한 글리칸 특이적 프로브를 사용하여 질병 특이적 글리콜-바이오 마커를 측정하는데 있어서, ELISA 또는 CLIA와 같은 일상적으로 사용되는 면역측정법(immunoassay)의 사용이 제한되었다. 한편, 렉틴은 피분석물이 존재하지 않더라도 포획 항체에 결합될 수 있고(도 1), 글리칸 구조는 예측하기 어렵고, batch-to-batch 변형이 용이하므로, 통제할 수 없는 상당한 공시험값(blank value)을 생성한다. 이와 같은 문제는 적절한 렉틴 및 무당질 항체를 사용하는 면역분석 플랫폼인 ALIQUAT(Aglycosylated antibody-Lectin coupled Immunoassay for the QUAntification of Tumor marker)을 통한 특정 글리코폼(glycoform) 분석에 의하여 해결될 수 있다(도 2). 따라서, 본 실시예에서는 게놈 편집에 의하여 무당질 항체를 생산하는 마우스를 확립하였다.Immunoglobulin G (IgG) is an N-linked glycoprotein, which, like normal glycoproteins, exhibits heterogeneity in glycan structures. Because of these properties, the use of routinely used immunoassays such as ELISA or CLIA has been limited in measuring disease specific glycol-biomarkers using glycan specific probes including lectins. On the other hand, lectins can bind to capture antibodies even when no analyte is present (FIG. 1), and glycan structures are difficult to predict, and batch-to-batch modifications are easy, resulting in uncontrolled significant blanks (blank). value). This problem can be solved by specific glycoform analysis using Aglycosylated antibody-Lectin coupled Immunoassay for the QUAntification of Tumor marker (ALIQUAT), an immunoassay platform that uses appropriate lectin and sugar-free antibodies (Figure 2). ). Therefore, in the present example, mice producing a non-saccharide antibody by genome editing were established.

2-1. 마우스 접합체의 게놈 편집 확인2-1. Confirm genome editing of mouse conjugates

HDR 효율성을 향상시키기 위해 여러 가지 접근 방법이 개발되었지만, 이와 같은 방법들은 여전히 비상동 말단 연결(Non-homologous end joining, NHEJ) 기반의 녹아웃(knock-out) 효율에 비해 상당히 낮다. 최근, 이중가닥 DNA의 절단 없이, 시토신 또는 아데닌 염기 기반 편집에 의해 높은 효율로 각각 'C-G to T-A' 또는 'A-T to G-C' 전환이 가능한 염기 편집 시스템(base editing system)이 개발되었다. C57BL/6의 IgG 유전자의 서열 분석 결과, 염기 편집 창(도 3) 내에서 IgG2b, IgG2c 및 IgG3가 N-글리코실화 아스파라긴 코딩 서열(AAC)에 편집 가능한 아데닌을 공유하는 것으로 나타났다. 하나 또는 둘 모두의 아데닌을 구아닌으로 전환시키면, 비-아스파라긴 코딩 서열이 생성되어 IgG에서 N-글리칸이 사라진다.Several approaches have been developed to improve HDR efficiency, but these methods are still significantly lower than knock-out efficiency based on Non-homologous end joining (NHEJ). Recently, a base editing system has been developed that enables 'C-G to T-A' or 'A-T to G-C' conversion, respectively, with high efficiency by cytosine or adenine base-based editing, without cleavage of double stranded DNA. Sequence analysis of the IgG gene of C57BL / 6 showed that within the base editing window (FIG. 3) IgG2b, IgG2c and IgG3 share an editable adenine to the N-glycosylated asparagine coding sequence (AAC). Conversion of one or both adenine to guanine produces a non-asparagine coding sequence that results in the disappearance of N-glycans in IgG.

따라서, 무당질 항체 생산 마우스를 확립하기 위하여, 실시예 1-3에 따라, C57BL/6 마우스 유래 접합체에 IgG2b, IgG2c 및 IgG3를 표적으로하는 가이드 RNA 및 ABE7.10 mRNA를 동시에 주입하여 해당 유전자의 변형을 유도하였다. 그 후, 실시예 1-4에 따라, 유전자형 분석을 수행하였다. 유전자형 분석은 ARMS(amplification refractory mutation system)에 의해 태어난 pup(n=24)에서 수행되었으며, 프라이머는 도 4 에서 화살표로 표시된 바와 같이, A에서 G로 전환될 때 다른 크기의 추가 PCR 생성물을 생성하도록 설계되었다(도 4). Therefore, in order to establish a sugar-free antibody-producing mouse, according to Example 1-3, the guide RNA and ABE7.10 mRNA targeting IgG2b, IgG2c and IgG3 were simultaneously injected into the C57BL / 6 mouse-derived conjugates of the gene. Deformation was induced. Then, according to Examples 1-4, genotyping was performed. Genotyping was performed in pups (n = 24) born by the amplification refractory mutation system (ARMS), and the primers were used to generate additional PCR products of different sizes when converted from A to G, as indicated by the arrows in FIG. 4. Designed (FIG. 4).

분석 결과, 모든 IgG 유전자에 대해 고효율의 A에서 G 로의 전환이 관찰되었다. 전환율(적어도 하나의 유전자좌의 전환)은 IgG2c가 79.1%(19/24), IgG2b가 87.5%(21/24), IgG3가 62.5%(15/24)인 것으로 확인되었다. 유전자형 선별 결과를 비교한 결과, 3개의 유전자에서 동시 전환을 나타내는 것으로 보이는 15마리의 pup을 확인하였으며, 그 중 9마리에 대해 개별적으로 생거 서열 분석을 수행하였다. 그 결과, 키메라 돌연변이가 포함된 경우, 9마리의 모든 pup에서 IgG2c(도 5), IgG2b(도 6) 및 IgG3(도 7)의 세 유전자좌에 돌연변이가 발생한 것으로 확인되었다. As a result, high efficiency A to G conversion was observed for all IgG genes. Conversion rates (at least one locus) were found to be 79.1% (19/24) for IgG2c, 87.5% (21/24) for IgG2b, and 62.5% (15/24) for IgG3. As a result of comparing the genotyping results, 15 pups which appeared to show simultaneous conversion in three genes were identified, and nine of them were individually subjected to Sanger sequence analysis. As a result, when chimeric mutations were included, it was confirmed that mutations occurred in all three loci of IgG2c (FIG. 5), IgG2b (FIG. 6) and IgG3 (FIG. 7) in all nine pups.

2-2. IgG2b, IgG2c 및 IgG3 유전자 편집된 intermediate founder 마우스 확립2-2. Establishing IgG2b, IgG2c and IgG3 Genetically Edited Intermediate Founder Mice

실시예 2-1에서 선별한 9마리의 pup 중, IgG1 유전자좌에서 게놈 편집을 수행하는데 사용하기 위하여, 다른 pup 대비 IgG2c(도 8), IgG2b(도 9) 및 IgG3(도 10) 유전자에서 이대립인자성(biallelic) "A to G" 전환율이 높은 pup(#11)을 선택하였다. 이 pup은 IgG2b에서 동형접합 돌연변이(homozygous mutation)를 보였으며 IgG2c와 IgG3에서 키메라 돌연변이를 보였다(도 11).Of the nine pups selected in Example 2-1, these alleles in the IgG2c (FIG. 8), IgG2b (FIG. 9) and IgG3 (FIG. 10) genes compared to other pups for use in performing genome editing at the IgG1 locus. A pup (# 11) with a high biallelic "A to G" conversion was selected. This pup showed a homozygous mutation in IgG2b and a chimeric mutation in IgG2c and IgG3 (FIG. 11).

구분division 편집된 표적 염기서열(5'→3')Edited target sequence (5 '→ 3') 서열번호SEQ ID NO: IgG2b IgG2b TAC G ACAGTACT C TCCGGGTGGTAC G ACAGTACT C TCCGGGTGG 서열번호 37SEQ ID NO: 37 IgG2c IgG2c TAC G ACAGTACTCTCCGGGTGGTAC G ACAGTACTCTCCGGGTGG 서열번호 38SEQ ID NO: 38 IgG3 IgG3 TAC G ACAGTACCTTCCGAGTGGTAC G ACAGTACCTTCCGAGTGG 서열번호 39SEQ ID NO: 39

게놈 편집된 pup과 야생형 C57BL/6 마우스의 교배하여 생긴 pup을 이형접합 돌연변이 pup과 수회 반복 교배 및 번식시켜 돌연변이 아미노산 모티프인 D-S-T, D-G-T, G-S-T 및 G-G-T 중 하나를 갖도록 고정하였다. D-S-T 돌연변이는 N-글리코실화 아스파라긴 잔기가 면역글로불린 β샌드위치 폴드(fold)의 두 가닥 사이에 노출된 루프에 위치하고 있기 때문에, 대전된 측쇄를 갖더라도, 아스파라긴과 동일한 기하학 구조를 나타내는 아스파르트산은 글리신(GST)에 비해 잠재적 기하학적 구조의 불안정성을 피할 수 있으므로, intermediate founder로써, D-S-T 돌연변이를 선택하였다. D-G-T 또는 G-S-T와 같은 두 가지 돌연변이의 도입은 구조물의 변형을 최소화하기 위해 배재하였다(도 12). intermediate founder를 사육하고, IgG1 유전자 편집을 위해 사용하였다.The pups resulting from the crossover of genome edited pups and wild type C57BL / 6 mice were repeatedly crossed and propagated with heterozygous mutant pups and fixed to have one of the mutant amino acid motifs D-S-T, D-G-T, G-S-T and G-G-T. Since the DST mutation is located in an exposed loop between two strands of the immunoglobulin β-sandwich folds, the N-glycosylated asparagine residues, aspartic acids, which have the same geometry as the asparagine, are glycine (GST) As the intermediate founder was selected, DST mutations were chosen because potential geometric instability could be avoided. The introduction of two mutations, such as D-G-T or G-S-T, was excluded to minimize modification of the construct (FIG. 12). The intermediate founder was bred and used for IgG1 gene editing.

2-3. IgG1, IgG2b, IgG2c 및 IgG3 유전자 편집된 founder 마우스 확립2-3. Establishing IgG1, IgG2b, IgG2c and IgG3 Gene Edited Founder Mice

IgG1의 표적 부위는 canonical(NGG)을 포함하지 않지만, 표적의 두 가닥 모두 NG PAM 서열만을 포함한다. 따라서, 가능한 인접 사이트를 표적으로하여 공여 DNA를 사용하여 HDR 매개 유전자 편집을 수행하였으나, IgG1 유전자가 편집된 pup을 생성할 수 없었다. 따라서, IgG1의 유전자 편집을 위하여, NG 서열에 대한 유전자 표적화 활성을 나타내는 실시예 1-2의 xCas9-ABE를 사용하여 실시예 1-3에 따라 IgG1 유전자를 편집하였다.The target site of IgG1 does not contain canonical (NGG), but both strands of the target contain only the NG PAM sequence. Therefore, HDR mediated gene editing was performed using donor DNA targeting the possible adjacent sites, but could not produce pups with edited IgG1 gene. Therefore, for gene editing of IgG1, IgG1 gene was edited according to Example 1-3 using xCas9-ABE of Example 1-2 showing gene targeting activity for NG sequence.

그 결과, 2개의 pup에서 heterogeneic 전환이 나타났으며, 하나의 대립유전자가 세린을 암호화하는 서열(TCA G CAGCACTTTCCGTTCAGT; IgG1; 서열번호 40)로 전환되었다(도 13). 편집된 pup을 homozygous IgG1이 될 때까지 수 회 반복 교배 및 번식시켰다. 모든 돌연변이는 생식선 전이(germ-line transmission)가 이루어졌고, IgG1, IgG2b, IgG2c 및 IgG3에서 누적된 무당질 돌연변이를 갖는 founder가 성공적으로 확립되었다. 4개의 대립유전자에서의 돌연변이는 생거 시퀀싱에 의해 다시 확인되었다. 구체적인 게놈 편집에 대한 절차는 표 7과 같다.As a result, heterogeneic conversion occurred in two pups, and one allele was converted to a sequence encoding serine (TCA G CAGCACTTTCCGTTCAGT; IgG1; SEQ ID NO: 40). The edited pups were repeatedly crossed and propagated several times until homozygous IgG1. All mutations resulted in germ-line transmission and successfully established founders with sugarless mutations accumulated in IgG1, IgG2b, IgG2c and IgG3. Mutations in the four alleles were again confirmed by Sanger sequencing. The procedure for specific genome editing is shown in Table 7.

SubclassSubclass 방법Way Effector proteinEffector protein Effector/gRNAEffector / gRNA Amino acid modificationAmino acid modification 접합자 수Number of adapters Pups bornPups born Mutants(monoallelic/biallelic)Mutants (monoallelic / biallelic) 수집collection 주입Injection 이식transplantation IgG1IgG1 Adenine base editingAdenine base editing xCas9-ABE7.10xCas9-ABE7.10 mRNA/RNAmRNA / RNA NST→SSTNST → SST 211211 196196 3232 1010 7/07/0 IgG2bIgG2b ABE7.10ABE7.10 NST→DSTNST → DST 405405 317317 112112 2424 10/1110/11 IgG2cIgG2c 12/712/7 IgG3IgG3 5/105/10

실시예 3. 게놈 편집된 마우스에서 인간 AFP에 대해 생성된 무당질 단일클론항체의 생산 확인Example 3 Confirmation of Production of Glucose Monoclonal Antibodies Generated Against Human AFP in Genomic Edited Mice

3-1. 면역글로불린의 모든 서브클래스 생산 능력 확인3-1. Identify all subclass production capacity of immunoglobulins

면역글로불린 G(IgG)의 N-글리코실화는 마우스, 토끼 및 인간을 포함하는 고등 진핵 생물 사이에서 고도로 보존되어있다. IgG N-글리코실화가 안정성을 부여하거나 면역 반응 조절에 관여한다는 보고가 있지만, 진화론적 압력으로 인하여 고등 생물체가 IgG의 N-글리코실화를 채택하게된 것인지는 명확하지 않다. N-glycosylation of immunoglobulin G (IgG) is highly conserved among higher eukaryotes, including mice, rabbits, and humans. Although it has been reported that IgG N-glycosylation confers stability or is involved in the regulation of immune responses, it is not clear whether evolutionary pressure led to higher organisms adopting N-glycosylation of IgG.

따라서, 결함이 있는 IgG가 생산되는지 확인하기 위하여, 실시예 2에서 확립된 게놈 편집된 마우스 유래 IgG에 대해 면역글로불린 아이소타이핑(isotyping) 키트를 사용하여 IgG 프로파일링을 수행하였다. Thus, IgG profiling was performed using an immunoglobulin isotyping kit against the genomic edited mouse derived IgG established in Example 2 to confirm that a defective IgG was produced.

그 결과, 게놈 편집된 마우스는 야생형 마우스와 동일한 프로파일을 보이는 것으로 확인되었다(도 14). 반면, IgG2b(도 15) 및 IgG3(도 16) 유전자가 녹아웃된 마우스는 상응하는 서브클래스(subclass)의 생산에 결함을 보이는 것으로 확인되었다. As a result, genome edited mice were found to show the same profile as wild type mice (FIG. 14). In contrast, mice knocked out of the IgG2b (FIG. 15) and IgG3 (FIG. 16) genes were found to exhibit defects in the production of the corresponding subclass.

이와 같은 결과를 통하여, 게놈 편집된 마우스는 면역글로불린의 모든 서브클래스를 생산할 수 있는 능력을 보유하고 있는 것으로 확인되었다.These results confirmed that genome edited mice possess the ability to produce all subclasses of immunoglobulins.

3-2. 무당질 항체 생산 확인3-2. Production of Glucose-Free Antibodies

게놈 편집된 마우스로부터 생산되는 항체가 무당질 항체인지 여부를 확인하였다.It was confirmed whether the antibody produced from the genome edited mouse was a sugar free antibody.

구체적으로, 간세포 암종(hepatocellular carcinoma)에서 가장 특징적인 종양 표지자 중 하나인 인간 AFP를 모델 항원으로 사용하였다. 동일한 양의 보조제로 유화한 인간 AFP를 6주령의 게놈 편집된 마우스(n=5)의 뒷발에 1주 간격으로 5회 주사하고, 각 면역 단계에서 혈청을 채취하여 hAFP에 대한 direct ELISA 분석을 수행하였다.Specifically, human AFP, one of the most characteristic tumor markers in hepatocellular carcinoma, was used as a model antigen. Human AFP emulsified with the same amount of adjuvant was injected 5 times at weekly intervals into the hind paw of 6-week-old genomic edited mice (n = 5), and serum was taken at each immunization step to perform direct ELISA analysis for hAFP. It was.

그 결과, 시간이 지남에 따라 증가된 반응성을 나타내는 것으로 확인되어(도 17), 면역화가 진행된 것으로 확인되었다.As a result, it was confirmed to show increased reactivity over time (FIG. 17), and it was confirmed that immunization proceeded.

면역화 후, 쥐에서 슬와림프절 세포를 채취하여 실시예 1-5에 따라 FO 골수종(myeloma) 세포와 융합시키고, HAT(hypoxanthine-aminopterin-thymidine) 함유 플레이트 상에 하이브리도마 세포의 콜로니를 형성시켜 666개의 하이브리도마 클론을 얻었다. After immunization, swarm lymph node cells were harvested from mice and fused with FO myeloma cells according to Examples 1-5, and colonies of hybridoma cells were formed on plates containing hypoxanthine-aminopterin-thymidine (666) to 666 Hybridoma clones were obtained.

그 결과, 하이브리도마 클론 중, 13.9% 클론(93개)에서 hAFP에 높은 반응성을 나타내는 항체가 분비되는 것으로 확인되었다(도 18). As a result, it was confirmed that among the hybridoma clones, antibodies showing high reactivity to hAFP were secreted in 13.9% clones (93) (FIG. 18).

3-3. 단일클론항체 생산성이 우수한 하이브리도마 클론 선별3-3. Selection of hybridoma clones with high monoclonal antibody productivity

항-hAFP 항체는 인간혈청알부민(human serum albumin, HAS)에 존재하는 에피토프에 대해 교차 반응을 나타낼 수 있으므로, HAS에 대한 반응성을 확인하여 반응성 클론을 제외하였다. 또한, 시간이 지남에 따라 항체 생산이 감소한 클론은 제외하고, 항체 생산이 지속되는 클론을 선별하여, 1E5, 2A2 및 3A5로 지정된 3개의 클론을 선별하였다. 3개의 클론은 모두 IgG1 서브클래스 및 카파(kappa) 경쇄의 단일클론항체를 분비하는 것으로 확인되었다(도 19). 또한, MS 분석을 통하여, 새롭게 형성된 돌연변이 영역에 O-linked 글리코실화와 같은 번역 후 변형(post-translational modification)은 존재하지 않는 것으로 확인되었다. The anti-hAFP antibody may cross-react to epitopes present in human serum albumin (HAS), thus responsiveness to HAS was excluded and reactive clones were excluded. In addition, three clones designated as 1E5, 2A2, and 3A5 were selected by selecting clones in which antibody production continued, except for clones whose antibody production decreased over time. All three clones were found to secrete monoclonal antibodies of IgG1 subclass and kappa light chain (FIG. 19). In addition, MS analysis confirmed that there were no post-translational modifications, such as O-linked glycosylation, in the newly formed mutant regions.

3-4. 선별된 하이브리도마 클론에서 생산된 항체의 무당화 확인3-4. Confirmation of Glycosylation of Antibodies Produced from Selected Hybridoma Clones

생성된 항체가 완전히 무당화된 것을 확인하기 위하여, Concanavalin A(Con-A)를 사용한 렉틴 블롯 분석 및 항-마우스 IgG 항체를 사용한 면역 블롯 분석을 수행하였다.To confirm that the resulting antibody was completely unglycosylated, lectin blot analysis using Concanavalin A (Con-A) and immunoblot analysis using anti-mouse IgG antibodies were performed.

그 결과, 화살표로 표시된 Con-A에 반응하는 상업적으로 구입한 항체와 달리, 항체(1E5)의 중쇄에는 N-글리칸이 없는 것으로 확인되었다(도 20). IgG는 CH2 영역 밖에도 N-글리칸의 전달이 가능하지만, 실시예 3-3에서 확립된 세 개의 클론은 N-글리코실화의 흔적을 나타내지 않는 것으로 확인되었다(도 21).As a result, it was confirmed that, unlike commercially purchased antibodies that respond to Con-A indicated by arrows, the heavy chain of antibody (1E5) was free of N-glycans (FIG. 20). Although IgG can deliver N-glycans outside the CH2 region, it was confirmed that the three clones established in Example 3-3 show no signs of N-glycosylation (FIG. 21).

실시예 4. 렉틴 결합 ELISA 분석에 따른 무당화 항체의 타당성 검사Example 4. Validation of Glycosylated Antibodies by Lectin-Binding ELISA Assay

4-1. L3-null AFP 표준을 만들기 위한 FUT84-1. FUT8 to create L3-null AFP standard -/--/- 돌연변이 클론 제작 Mutant clone production

HEK293-T 세포는 GDP-푸코오스(fucose)에서 core N-글리칸으로의 푸코오스 전이를 촉매하는 FUT8(alpha-(1,6)-fucosyltransferase)를 발현한다. FUT8 유전자에는 3가지 스플라이싱 변이가 존재하고, 촉매 활성과 관련이 있고, 모든 변이형이 공유하는 엑손 9 및 11은 글리코실트랜스퍼라아제(glycosyltransferase) 패밀리 23에 속한다. HEK293-T cells express FUT8 (alpha- (1,6) -fucosyltransferase), which catalyzes the fucose transfer from GDP-fucose to core N-glycans. There are three splicing mutations in the FUT8 gene, which are related to catalytic activity, and exons 9 and 11, which all variants share, belong to glycosyltransferase family 23.

ALIQUAT(Aglycosylated antibody-Lectin coupled Immunoassay for the QUAntification of Tumor marker) 시스템을 확립하기 위하여, 실시예 1-10에 따라 무당화 항체의 생산 가능성을 샌드위치 ELISA 플랫폼에서 테스트하기에 앞서, AFP-L3이 결핍된 hAFP 표준을 얻는 것이 중요하므로, L3-null AFP 표준을 만들기 위하여, 실시예 1-7에 따라 CRISPR-Cas9으로 엑손 9 및 11을 각각 표적화하였다.In order to establish an Aglycosylated Antibody-Lectin Coupled Immunoassay for the QUAntification of Tumor marker (ALIQUAT) system, prior to testing the production potential of aglycosylated antibodies according to Examples 1-10 on a sandwich ELISA platform, AFP-L3 deficient Since it is important to obtain hAFP standards, exons 9 and 11 were targeted with CRISPR-Cas9, respectively, according to Examples 1-7 to make L3-null AFP standards.

그 결과, 틀이동 넌센스 돌연변이를 나타내는 FUT8 -/- 돌연변이 클론을 얻었다(도 22). As a result, a FUT8 − / − mutant clone indicating a nontransformed nonsense mutation was obtained (FIG. 22).

4-2. FUT84-2. FUT8 -/--/- 세포의 AFP-L3을 생성 여부 확인 Determine whether cells produce AFP-L3

FUT8 유전자 제거에 의한 기능적 손실을 조사하기 위하여, core-fucosylated N-glycan에 특이적인 결합성을 나타내는 것으로 알려진 PhoSL(mushroom Pholiota squarrosa) 유래 렉틴을 사용하여 실시예 1-9에 따라 렉틴 결합 테스트를 수행하였다. 면역 형광(immunofluorescence) 분석 수행 결과, FUT8 -/- HEK293-T 세포는 PhoSL 결합성이 없는 것으로 확인되었다(도 23).To investigate functional loss by FUT8 gene deletion, lectin binding tests were performed according to Examples 1-9 using pulsines derived from mushroom pholiota squarrosa (PhoSL) known to exhibit specific binding to core-fucosylated N-glycan It was. Immunofluorescence analysis showed that FUT8 − / − HEK293-T cells were not PhoSL bound (FIG. 23).

한편, hAFP는 야생형 및 FUT8 -/- HEK293-T 세포 모두에서 과발현되었고, 렉틴 친화도 전기영동을 위하여 조건 배지를 수득하였다. AFP-L3과 AFP-L1이 다른 이동성을 나타내도록 Lens culinaris agglutinin이 포함된 아가로오스 젤에서 단백질의 전기영동을 수행하였다. 항-hAFP 항체를 사용하여 면역 블롯 분석하여 AFP의 다른 glycoform을 시각화하였다(도 24). AFP-L3는 야생형 HEK293-T 세포로부터 얻은 AFP glycoform의 대부분을 차지하는 반면, FUT8 -/- 세포는 AFP-L3을 생성하지 않는 것으로 확인되었다. 또한, 질량분석 결과, FUT8 -/- 세포에서 AFP-L3는 나타나지 않는 것으로 확인되었고, 야생형 세포에서 AFP-L3의 생성비율은 99.5%인 것으로 확인되었으며(도 25), μ-Tas 분석에서도 유사한 결과를 확인하였다.On the other hand, hAFP was overexpressed in both wild-type and FUT8 − / − HEK293-T cells, and conditioned media was obtained for lectin affinity electrophoresis. Protein electrophoresis was performed on an agarose gel containing Lens culinaris agglutinin so that AFP-L3 and AFP-L1 exhibited different mobility. Immune blot analysis using anti-hAFP antibodies to visualize other glycoforms of AFP (FIG. 24). AFP-L3 accounts for the majority of AFP glycoforms obtained from wild-type HEK293-T cells, whereas FUT8 − / − cells were found not to produce AFP-L3. In addition, it was confirmed that the mass spectrometry did not show AFP-L3 in FUT8 − / − cells, and the production rate of AFP-L3 in wild-type cells was 99.5% (FIG. 25), and similar results in μ-Tas analysis. It was confirmed.

4-3. ALIQUAT 시스템에 있어서, 무당질 항체의 타당성 확인4-3. Validation of Glucose-Free Antibodies in the ALIQUAT System

canonical sandwich ELISA 및 AAL을 사용하는 lectin-coupled ELISA 분석에 의해 표준 곡선을 작성하였다. Standard curves were prepared by lectin-coupled ELISA analysis using canonical sandwich ELISA and AAL.

구체적으로, canonical sandwich ELISA의 경우, 무당질 항체(1E5) 또는 상업적 항체를 포획(capture) 항체로 사용하였다. 검출(detection) 항체 쌍은 상업적으로 이용 가능한 항체 중, 포획 항체와 메칭되는 항체를 선택하였다. 표준 곡선 분석 결과, 유효성이 확인된 시판 항체와 비교하여 민감도는 낮지만, 무당질 항체는 0-20ng/mL AFP의 범위에서 우수한 선형성을 나타내는 것으로 확인되었다(도 26). Specifically, in the case of a canonical sandwich ELISA, a sugar-free antibody (1E5) or a commercial antibody was used as a capture antibody. Detection antibody pairs were selected from among commercially available antibodies that matched capture antibodies. As a result of the standard curve analysis, although the sensitivity was lower than that of the commercially available commercially available antibody, the glycosylated antibody showed excellent linearity in the range of 0-20 ng / mL AFP (FIG. 26).

무당질 항체의 타당성은 AAL 렉틴을 사용한 AFP-L3 테스트에 의해 증명되었다(도 27). 상업적 항체를 사용한 렉틴 ELISA는 상당한 공시험값(blank value)을 나타내었고, L3 양성 AFP의 증가된 농도는 높은 표준 오차(standard error)를 갖는 광학 밀도의 선형 증가를 반영하지 않았다. 이 패턴은 L3 양성 및 음성 AFP 샘플 모두에서 유사하게 관찰되었다. 그러나 무당질 항체를 사용한 렉틴 ELISA 분석은 L3 양성 AFP 샘플에 대한 선형성이 우수한 표준 곡선을 만들었다. 0-1,000ng/mL의 범위에서 어떠한 간섭도 관찰되지 않았으며, 특정 글리코폼(glycoform)의 정량화를 위한 분석 플렛폼의 제공에 있어서, 렉틴과 무당질 항체의 조합적 사용에 따른 분석의 타당성을 확인하였다.The validity of the sugar free antibody was demonstrated by the AFP-L3 test using AAL lectin (FIG. 27). Lectin ELISA with commercial antibodies showed significant blank values, and the increased concentration of L3-positive AFP did not reflect a linear increase in optical density with high standard error. This pattern was similarly observed in both L3 positive and negative AFP samples. However, lectin ELISA analysis using a sugar free antibody produced a standard curve with good linearity for L3-positive AFP samples. No interference was observed in the range of 0-1,000 ng / mL, and the validation of the assay with the combined use of lectins and sugar-free antibodies in providing an assay platform for the quantification of specific glycoforms was confirmed. It was.

실시예 5. 무당질 기반 렉틴-ELISA hAFP 테스트의 μ-TAS 분석 대체 가능성 확인Example 5 Confirmation of Replacement of μ-TAS Assay of Glucose-Based Lectin-ELISA hAFP Test

μ-TAS는 LCA가 내장된 모세관에서 AFP-L3의 이동을 전기영동으로 분석하는 체외 진단용 면역 분석기이다. 분석기의 고감도 및 견고성과 AFP-L3 측정의 임상적 유용성 때문에, μ-TAS는 HCC 진행의 위험성 평가를 위한 시험관 내 검사의 FDA 승인을 받았다. 분석적 타당성과 임상적 유용성에도 불구하고 μ-TAS 분석은 임상적 용도에 몇 가지 한계가 있다. 일반적으로 고비용을 요하는 분석이므로, 암 검진을 위한 일상적인 임상적 사용이 제한된다. 또한, μ-TAS는 AFP-L3의 용도로 개발되었으며, 다른 글리코폼 분석에 사용하기 어렵다. μ-TAS is an in vitro diagnostic immunoassay that electrophorically analyzes the transport of AFP-L3 in LCA-embedded capillaries. Because of the high sensitivity and robustness of the analyzer and the clinical usefulness of the AFP-L3 measurement, μ-TAS has received FDA approval of in vitro tests for risk assessment of HCC progression. Despite the analytical validity and clinical utility, the μ-TAS assay has some limitations in clinical use. As it is generally a costly assay, routine clinical use for cancer screening is limited. In addition, μ-TAS was developed for the use of AFP-L3 and is difficult to use for other glycoform analysis.

반면, ALIQUAT 방법은 다양한 질병 특이적 형태의 검출을 위한 범용적이고 보편적인 플랫폼을 제공할 수 있다. 다만, ALIQUAT 플랫폼은 글리코폼 특이적 프로브 및 무당질 항체가 이용 가능한 경우에만 다른 질병 특이적 글리코폼의 테스트에 용이하게 적용될 수 있다. 종양 특이적 바이오마커에 대한 특이성을 가진 다양한 렉틴이 이미 이용 가능하므로, 본 발명의 게놈 편집된 마우스로부터 용이하게 생산될 수 있는 무당질 항체가 ALIQUAT 방법에 적용될 수 있는지 확인하기 위하여, 무당질 항체(1E5)가 마그네틱 비드에 컨쥬게이션되어 혈청에서 hAFP를 탐지하고 푸코실화된(fucosylated) 형태가 AAL로 추적되는 화학발광 면역분석(chemiluminescent immunoassay, CLIA) 플랫폼에 임상 샘플을 적용하여 분석의 타당성 여부를 확인하였다.On the other hand, the ALIQUAT method can provide a universal and universal platform for the detection of various disease specific forms. However, the ALIQUAT platform can be easily applied to the testing of other disease specific glycoforms only when glycoform specific probes and sugar-free antibodies are available. Since a variety of lectins with specificity for tumor specific biomarkers are already available, in order to determine if aglycosyl antibodies that can be readily produced from the genome edited mice of the invention can be applied to the ALIQUAT method, 1E5) is conjugated to magnetic beads to detect hAFP in serum and the clinical sample is applied to a chemiluminescent immunoassay (CLIA) platform where the fucosylated form is traced to AAL to confirm the validity of the assay. It was.

구체적으로, AFP-L3 표준 분자를 1.0ng/mL 미만의 AFP 수준을 나타내는 정상 혈청에 스파이크하였다. 표준 곡선은 0-100ng/mL의 범위에서 양호한 선형성을 보였다(도 28). 그 다음, 정상적인 지원자와 hepatitis, cirrhosis 및 hepatocellular carcinoma 환자에서 혈청(n=19)을 채취하였다. 100ng/mL보다 높은 AFP 수준을 나타내는 혈청에 대해서는 농도가 표준 곡선 범위 내에 있도록 희석하였다. 각각의 혈청을 균등 부피로 나누고, ALIQUAT 방법 및 실시예 1-8에 따른 μ-TAS 분석을 통해 측정하였다. Specifically, AFP-L3 standard molecules were spiked into normal serum showing AFP levels below 1.0 ng / mL. Standard curves showed good linearity in the range of 0-100 ng / mL (FIG. 28). Serum (n = 19) was then collected from normal volunteers and patients with hepatitis, cirrhosis and hepatocellular carcinoma. For sera that exhibited AFP levels higher than 100 ng / mL, the concentrations were diluted to fall within the standard curve range. Each serum was divided into equal volumes and measured via ALIQUAT method and μ-TAS analysis according to Examples 1-8.

측정된 값을 X 축에 대해서는 AFP 수준으로, Y 축에 대해서는 %AFP-L3로 플롯하고, 두 플랫폼에서 얻은 각 값을 비교한 결과, 비교 분석은 p value > 0.05를 나타내어, 두 검사가 실질적으로 동일한 결과를 나타내는 것으로 확인되었다(도 29). Plot the measured values at the AFP level for the X axis and% AFP-L3 for the Y axis, and comparing each value obtained from the two platforms, the comparative analysis showed p value> 0.05, indicating that both tests were substantially The same result was confirmed (FIG. 29).

실시예 6. 무당질 항체의 보존된 단백질의 안정성Example 6. Stability of Conserved Proteins of Glucoprotein

단백질 글리코실화는 단백질 기능, 단백질-단백질 상호 작용, 세포-숙주 인식 등 다양한 효과를 나타낸다. 또한, 단백질 글리칸은 in vivo 및 in vitro에서 단백질 안정성을 부여하는 것으로 알려져 있다(Bowden 2012). 따라서, 무당질화에 의하여 항체가 저장 및 시험 중에 단백질 안정성을 상실하는지 여부를 실시예 1-11에 따라 확인하였다. Protein glycosylation exhibits a variety of effects, including protein function, protein-protein interactions, and cell-host recognition. Protein glycans are also known to confer protein stability in vivo and in vitro (Bowden 2012). Thus, it was confirmed in accordance with Examples 1-11 whether the antibody lost protein stability during storage and testing by deglycosylation.

구체적으로, 다양한 조건에서 항체의 안정성을 조사하고자 시판되는 글리코실화된 항체와 PNGase-F 처리에 의해 생성된 탈글리코실화(deglycosylate)된 형태의 항체를 대조군으로 비교하였다. Specifically, commercially available glycosylated antibodies and deglycosylated forms of antibodies produced by PNGase-F treatment to compare the stability of the antibodies under various conditions were compared as controls.

6-1. 단백질의 열 안정성 확인6-1. Confirmation of Thermal Stability of Proteins

PBS 버퍼에서 다양한 형태의 항체를 14일 동안 4℃ 및 37℃의 조건으로 방치하였다. 탈글리코실화 항체는 화살표로 나타낸 바와 같이 2개의 상이한 분해 단편(degradation fragment)을 나타내는 것으로 확인되었다(도 30). 처리 초기에 단편이 관찰되었기 때문에, 단편 중 분자량이 약 35kDa인 단편은 PNGase-F 처리에 의하여 발생한 것으로 확인되었다. 단편 중, 분자량이 약 50kDa인 단편은 37℃에서 시간에 따라 증가한 것으로 확인하였다. 그러나 본래의 글리코실화된 형태는 조사된 조건 하에서 어떠한 분해 생성물도 나타내지 않았다. 유사하게, 우리는 겔상에서 무당질 항체에 대한 분해 산물의 흔적을 검출할 수 없었다. Various types of antibodies were left in PBS buffer at conditions of 4 ° C. and 37 ° C. for 14 days. Deglycosylated antibodies were found to exhibit two different degradation fragments as indicated by the arrows (FIG. 30). Since fragments were observed at the beginning of the treatment, the fragments having a molecular weight of about 35 kDa were confirmed to be generated by PNGase-F treatment. Of the fragments, the fragments having a molecular weight of about 50 kDa were found to increase with time at 37 ° C. However, the original glycosylated form did not show any degradation products under the conditions investigated. Similarly, we were unable to detect traces of degradation products for the sugar free antibody on the gel.

이와 같은 결과를 통하여, 글리칸 자체의 부재보다는 탈글리코실화 반응 조건에 의해 단백질의 안정성이 더욱 손실되는 것을 확인하였다.Through these results, it was confirmed that the stability of the protein is further lost by the deglycosylation reaction condition than the absence of glycan itself.

6-2. 단백질의 pH 안정성 확인6-2. Confirm pH stability of protein

항체는 다양한 반응 조건 또는 정제 과정에서 pH의 변화에 노출될 수 있다. 따라서, 다양한 pH 조건에서 다양한 글리코폼 항체의 안정성을 조사하였다.Antibodies can be exposed to changes in pH during various reaction conditions or purification procedures. Therefore, the stability of various glycoform antibodies at various pH conditions was investigated.

구체적으로, 37℃에서 14일 동안 pH 3.0, 7.0 및 10.0의 버퍼에서 인큐베이션한 항체를 hAFP 측정에서 검출 항체로 사용하였다. 테스트의 광학 밀도 값을 측정하여 단백질의 결합력을 평가하였다. 그 결과, 글리코실화 및 무당질 항체는 유사한 안정성을 나타내는 것으로 확인되었다(도 31). 두 종류의 항체 모두 중성(pH 7.0) 조건에서 14일 동안 높은 안정성을 나타내었고 염기성 (pH 10.0) 조건에서 높은 저항성을 나타낸 반면, pH 3.0에서는 시간에 따라 안정성이 감소하였다. 대조적으로, 탈글리코실화된 형태는 중성 pH에서도 온전성(integrity)에서 상당한 손실을 보였다. pH 7.0에서 14일간 항온 배양한 항체 중 약 50%의 항체가 결합력을 상실하였으며 pH 10.0에서 배양한 경우 손실이 더 두드러졌다. 특히, 탈글리코실화된 형태는 pH 3.0에서 4일 동안 배양할 경우 결합력이 완전히 손실되는 것으로 확인되었다. Specifically, antibodies incubated in buffers of pH 3.0, 7.0 and 10.0 at 37 ° C. for 14 days were used as detection antibodies in hAFP measurements. The optical density value of the test was measured to assess the binding force of the protein. As a result, the glycosylated and sugar-free antibodies were found to show similar stability (FIG. 31). Both antibodies showed high stability for 14 days in neutral (pH 7.0) conditions and high resistance in basic (pH 10.0) conditions, while stability decreased with time at pH 3.0. In contrast, the deglycosylated form showed significant loss in integrity even at neutral pH. Of the antibodies incubated at pH 7.0 for 14 days, about 50% of the antibodies lost their binding capacity and were more pronounced when incubated at pH 10.0. In particular, the deglycosylated form was found to completely lose binding capacity when incubated at pH 3.0 for 4 days.

6-3. 산화 조건에 대한 단백질의 안정성 확인6-3. Confirmation of Protein Stability Against Oxidation Conditions

산화 조건 하에서 항체의 온전성에 대해 조사한 결과, 글리코실화 및 무당질 항체 모두 이러한 조건에 대한 저항성을 나타내는 것으로 확인되었으며, 이는 탈글리코실화된 형태의 물리적 특성과 상당히 대조적이었다(도 32). 무당질 항체는 3.0% H 2O 2를 함유하는 PBS 완충액에서 1시간 동안 항온 처리한 경우, 10% 미만의 온전성 손실을 나타냈다. 그러나, 탈글리코실화된 항체는 이러한 조건 하에서 약 50%의 결합활성(avidity) 손실이 확인되었다. 이와 같은 결과를 통하여, 글리코실화된 면역글로불린 G 대비 무당질 항체의 안정성이 낮아지지 않는 것으로 확인되었다.Investigations into the integrity of the antibody under oxidizing conditions have shown that both glycosylated and sugarless antibodies exhibit resistance to these conditions, which is in stark contrast to the physical properties of the deglycosylated form (FIG. 32). Glucose-free antibodies showed less than 10% integrity loss when incubated for 1 hour in PBS buffer containing 3.0% H 2 O 2 . However, deglycosylated antibodies have been found to lose about 50% of avidity under these conditions. Through these results, it was confirmed that the stability of the glycosylated antibody relative to glycosylated immunoglobulin G was not lowered.

이제까지 본 발명에 대하여 그 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.So far, the present invention has been described with reference to the embodiments. Those skilled in the art will appreciate that the present invention can be implemented in a modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered in descriptive sense only and not for purposes of limitation. The scope of the present invention is shown not in the above description but in the claims, and all differences within the scope will be construed as being included in the present invention.

Claims (19)

IgG(immunoglobulin G) 유전자를 암호화하는 DNA에 혼성화하는 하나 이상의 gRNA(guide RNA)를 암호화하는 뉴클레오티드 서열; Nucleotide sequences encoding one or more gRNAs (guide RNAs) that hybridize to DNA encoding an IgG (immunoglobulin G) gene; Cas9 단백질을 암호화하는 뉴클레오티드 서열; Nucleotide sequences encoding Cas9 proteins; ABE(adenine base editor)를 암호화하는 뉴클레오티드 서열; 및Nucleotide sequences encoding adenine base editors (ABEs); And 상기 뉴클레오티드 서열에 작동가능하게 연결된 프로모터A promoter operably linked to said nucleotide sequence 를 포함하는 재조합 발현벡터 또는 상기 재조합 발현벡터로부터 생산된 RNA.Recombinant expression vector comprising or RNA produced from the recombinant expression vector. 제 1 항에 있어서, 상기 IgG는 IgG1, IgG2a, IgG2b, IgG2c 및 IgG3으로 이루어진 군으로부터 선택되는 하나 이상의 IgG인 것인 재조합 발현 벡터 또는 상기 재조합 발현벡터로부터 생산된 RNA.The recombinant expression vector or RNA produced from the recombinant expression vector according to claim 1, wherein the IgG is at least one IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3. 제 1 항에 있어서, 상기 gRNA는 서열번호 2 내지 5로 이루어진 군으로부터 선택되는 어느 하나의 서열에 상보적인 뉴클레오티드 서열을 포함하는 것인 재조합 발현 벡터 또는 상기 재조합 발현벡터로부터 생산된 RNA.The recombinant expression vector or RNA produced from the recombinant expression vector according to claim 1, wherein the gRNA comprises a nucleotide sequence complementary to any one sequence selected from the group consisting of SEQ ID NOs: 2 to 5. 5. 제 1 항의 재조합 발현 벡터 또는 RNA가 도입된 무당질 항체(aglycosylated antibody) 생산용 동물모델의 제작용 형질전환 세포주 또는 수정란.A recombinant cell line or fertilized egg for the production of an animal model for producing an aglycosylated antibody into which the recombinant expression vector or RNA of claim 1 is introduced. 제 4 항의 수정란을 인간을 제외한 동물인 대리모의 난관에 이식하는 단계Transplanting the fertilized egg of claim 4 into the fallopian tube of a surrogate mother, an animal other than human 를 포함하는 무당질 항체 생산용 동물모델의 제조방법.Method of producing an animal model for the production of a sugar-free antibody comprising a. 제 5 항에 있어서, 상기 동물은 토끼, 염소 또는 마우스(mouse)인 것인 무당질 항체 생산용 동물모델의 제조방법. The method of claim 5, wherein the animal is a rabbit, goat or mouse. 제 5 항에 있어서, 상기 무당질 항체의 생산은 IgG1, IgG2a, IgG2b, IgG2c 및 IgG3으로 이루어진 군으로부터 선택되는 하나 이상의 IgG의 변형에 의한 것인 무당질 항체 생산용 동물모델의 제조방법.The method of claim 5, wherein the production of the sugar-free antibody is a method for producing an animal model for a sugar-free antibody is produced by the modification of one or more IgG selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3. 제 7 항에 있어서, 상기 변형은8. The method of claim 7, wherein the modification is 서열번호 2에 해당하는 서열이 서열번호 40의 서열로 치환;The sequence corresponding to SEQ ID NO: 2 is replaced with the sequence of SEQ ID NO: 40; 서열번호 3에 해당하는 서열이 서열번호 37의 서열로 치환;The sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37; 서열번호 4에 해당하는 서열이 서열번호 38의 서열로 치환; 및The sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38; And 서열번호 5에 해당하는 서열이 서열번호 39의 서열로 치환The sequence corresponding to SEQ ID NO: 5 is replaced with the sequence of SEQ ID NO: 39 으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것인 무당질 항체 생산용 동물모델의 제조방법.Method of producing an animal model for the production of a glycoside-free antibody that is generated by one or more substitutions selected from the group consisting of. IgG(immunoglobulin G) 유전자가 변형된 무당질 항체 생산용 동물모델.Animal model for the production of glycosylated antibody with modified IgG (immunoglobulin G) gene. 제 9 항에 있어서, 상기 변형은 10. The method of claim 9, wherein the modification IgG1 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환;In the amino acid sequence of the IgG1 heavy chain amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S; IgG2b 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환;In the amino acid sequence of an IgG2b heavy chain amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S; IgG2c 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환 ; 및In the amino acid sequence of the IgG2c heavy chain, amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S; And IgG3 중쇄의 아미노산 서열에서 N-S-T 서열 중 아미노산 N이 N외의 다른 아미노산으로 치환되거나, 또는 S가 P로 치환되거나, 또는 T가 S가 아닌 다른 아미노산으로 치환;In the amino acid sequence of an IgG3 heavy chain amino acid N in the N-S-T sequence is substituted with an amino acid other than N, S is substituted with P, or T is substituted with an amino acid other than S; 으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것인 무당질 항체 생산용 동물모델.Animal model for the production of a sugar-free antibody that is generated by one or more substitutions selected from the group consisting of. 제 10 항에 있어서, 상기 N-S-T 서열은 IgG1, IgG2a, IgG2b, IgG2c 및 IgG3로 이루어진 군으로부터 선택되는 어느 하나의 IgG 중쇄의 297번 내지 299번 아미노산 서열인 것인 무당질 항체 생산용 동물모델.The animal model of claim 10, wherein the N-S-T sequence is amino acid sequence 297 to 299 of any one IgG heavy chain selected from the group consisting of IgG1, IgG2a, IgG2b, IgG2c and IgG3. 제 9 항에 있어서, 상기 변형은10. The method of claim 9, wherein the modification 서열번호 2에 해당하는 서열이 서열번호 40의 서열로 치환;The sequence corresponding to SEQ ID NO: 2 is replaced with the sequence of SEQ ID NO: 40; 서열번호 3에 해당하는 서열이 서열번호 37의 서열로 치환;The sequence corresponding to SEQ ID NO: 3 is replaced with the sequence of SEQ ID NO: 37; 서열번호 4에 해당하는 서열이 서열번호 38의 서열로 치환; 및The sequence corresponding to SEQ ID NO: 4 is replaced with the sequence of SEQ ID NO: 38; And 서열번호 5에 해당하는 서열이 서열번호 39의 서열로 치환The sequence corresponding to SEQ ID NO: 5 is replaced with the sequence of SEQ ID NO: 39 으로 이루어진 군으로부터 선택되는 하나 이상의 치환에 의하여 발생된 것인 무당질 항체 생산용 동물모델.Animal model for the production of a sugar-free antibody that is generated by one or more substitutions selected from the group consisting of. 제 9 항에 있어서, 상기 동물은 토끼, 염소 또는 마우스인 것인 무당질 항체 생산용 동물모델.10. The animal model of claim 9, wherein the animal is rabbit, goat or mouse. 제 9 항의 동물모델에 진단하고자 하는 항원을 투여하는 단계를 포함하는 항원에 대한 무당질 항체의 생산방법.10. A method for producing a sugar-free antibody against an antigen comprising administering an antigen to be diagnosed to the animal model of claim 9. 제 14 항의 무당질 항체의 생산방법으로 생산된 무당질 항체.A sugar free antibody produced by the method for producing a sugar free antibody of claim 14. 제 15 항의 무당질 항체; 및A sugarless antibody of claim 15; And 당단백질 바이오마커Glycoprotein Biomarkers 를 포함하는 면역진단키트.Immunodiagnostic kit comprising a. 제 16 항에 있어서, 상기 당단백질 바이오마커는 렉틴에 의해 검출되는 것인 면역진단키트.The immunodiagnostic kit of claim 16, wherein the glycoprotein biomarker is detected by lectin. 제 17 항에 있어서, 상기 렉틴은 상기 당단백질 바이오마커를 특이적으로 검출할 수 있는 렉틴인 것인 면역진단키트.18. The immunodiagnostic kit according to claim 17, wherein the lectin is a lectin capable of specifically detecting the glycoprotein biomarker. 제 16 항에 있어서, 상기 당단백질은 AFP-L3인 것인 면역진단키트.The immunodiagnostic kit of claim 16, wherein the glycoprotein is AFP-L3.
PCT/KR2019/006912 2018-06-07 2019-06-07 Transgenic mouse for aglycosylated antibody production and use of aglycosylated antibody produced therefrom Ceased WO2019235895A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP19814996.5A EP3804512A4 (en) 2018-06-07 2019-06-07 TRANSGENIC MOUSE FOR THE PRODUCTION OF AGLYCOSYLATED ANTIBODIES AND USE OF AN AGLYCOSYLATED ANTIBODY PRODUCED THEREFROM
US16/972,803 US12048296B2 (en) 2018-06-07 2019-06-07 Transgenic mouse for aglycosylated antibody production and use of aglycosylated antibody produced therefrom
AU2019283621A AU2019283621B2 (en) 2018-06-07 2019-06-07 Transgenic mouse for aglycosylated antibody production and use of aglycosylated antibody produced therefrom
CN201980050543.5A CN112512310B (en) 2018-06-07 2019-06-07 Transgenic mice for aglycosylated antibody production and use of aglycosylated antibodies produced thereby
JP2020568257A JP7268059B2 (en) 2018-06-07 2019-06-07 Transgenic mice for the production of aglycosylated antibodies and uses of the aglycosylated antibodies produced therefrom

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20180065394 2018-06-07
KR10-2018-0065394 2018-06-07

Publications (1)

Publication Number Publication Date
WO2019235895A1 true WO2019235895A1 (en) 2019-12-12

Family

ID=68770889

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2019/006912 Ceased WO2019235895A1 (en) 2018-06-07 2019-06-07 Transgenic mouse for aglycosylated antibody production and use of aglycosylated antibody produced therefrom

Country Status (7)

Country Link
US (1) US12048296B2 (en)
EP (1) EP3804512A4 (en)
JP (1) JP7268059B2 (en)
KR (1) KR102170788B1 (en)
CN (1) CN112512310B (en)
AU (1) AU2019283621B2 (en)
WO (1) WO2019235895A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113061605A (en) * 2020-07-13 2021-07-02 中山大学 Construction method and application of fucose transferase 8(FUT8) function-deficient cell strain

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114934053B (en) * 2022-06-30 2024-02-06 澳斯康生物(南通)股份有限公司 Fucosyltransferase 8-defective CHO cell line and preparation method and application thereof

Family Cites Families (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4208479A (en) * 1977-07-14 1980-06-17 Syva Company Label modified immunoassays
US6080910A (en) 1997-02-20 2000-06-27 Case Western Reserve University Transgenic knockout animals lacking IgG3
CA2953239A1 (en) 2000-10-06 2002-04-18 Kyowa Hakko Kirin Co., Ltd. Antibody composition-producing cell
SI1713503T1 (en) 2004-02-10 2013-12-31 The Regents Of The University Of Colorado, A Body Corporate Inhibition of factor b, the alternative complement pathway and methods related thereto
US20080019905A9 (en) * 2005-02-18 2008-01-24 Strome Scott E Method of using an anti-CD137 antibody as an agent for radioimmunotherapy or radioimmunodetection
CA2673470A1 (en) * 2006-12-21 2008-07-03 Macrogenics, Inc. Methods for the treatment of lada and other adult-onset autoimmune diabetes using immunosuppressive monoclonal antibodies with reduced toxicity
ES2647767T3 (en) 2007-12-03 2017-12-26 Syngenta Participations Ag Genetic engineering of enzymatically susceptible proteins
EP2229410A4 (en) 2007-12-05 2012-07-04 Massachusetts Inst Technology AGLYCOSYLATED IMMUNOGLOBULIN MUTANTS
EP2279003A4 (en) * 2008-05-01 2013-04-03 Gtc Biotherapeutics Inc ANTI-CD137 ANTIBODIES AS AN AGENT IN THE TREATMENT OF INFLAMMATORY CONDITIONS
CN102625915B (en) * 2009-07-14 2014-12-31 独立行政法人产业技术综合研究所 Glycoprotein assay method, reagent and sugar chain marker
WO2011116387A1 (en) * 2010-03-19 2011-09-22 Tetragenetics, Inc. Production of aglycosylated monoclonal antibodies in ciliates
WO2013102123A2 (en) * 2011-12-28 2013-07-04 Novelmed Therapeutics, Inc. Aglycosylated human antibody and fusion protein and uses thereof
US9580486B2 (en) 2013-03-14 2017-02-28 Amgen Inc. Interleukin-2 muteins for the expansion of T-regulatory cells
CN106455512A (en) 2014-04-28 2017-02-22 美国陶氏益农公司 Haploid maize transformation
US9790490B2 (en) * 2015-06-18 2017-10-17 The Broad Institute Inc. CRISPR enzymes and systems
KR101863653B1 (en) * 2016-06-02 2018-06-05 전남대학교 산학협력단 Knock in vector for expressing lactoferrin and knock in method using thereof
KR101883886B1 (en) * 2016-10-27 2018-08-01 국민대학교 산학협력단 Aglycosylated Antibody Fc Region for Treating Cancer

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
GAUDELLI, N. M.: "Programmable base editing of A-T to G-C in genomic DNA without DNA cleavage", NATURE, 23 November 2017 (2017-11-23), pages 1 - 37, XP002785203 *
HRISTODOROV, D.: "Generation and comparative characterization of glycosylated and aglycosylated human IgGl antibodies", MOLECULAR BIOTECHNOLO GY, 17 March 2012 (2012-03-17), pages 326 - 335, XP055217033 *
JU, M.-S.: "Aglycosylated full-length IgG antibodies: steps toward next- generation immunotherapeutics", CURRENT OPINION IN BIOTECHNOLOGY, vol. 30, 16 July 2014 (2014-07-16), pages 128 - 139, XP055767804 *
LI, W.: "Crystallizable fragment glycoengineering for therapeutic antibodies development", FRONTIERS IN IMMUNOLOGY, 13 November 2017 (2017-11-13), pages 1 - 15, XP055662238 *
See also references of EP3804512A4 *
ZHANG, P.: "Challenges of glycosylation analysis and control: an integrated approach to producing optimal and consistent therapeutic drugs", DRUG DISCOVERY TODAY, May 2016 (2016-05-01), pages 7 40 - 765, XP029543922 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113061605A (en) * 2020-07-13 2021-07-02 中山大学 Construction method and application of fucose transferase 8(FUT8) function-deficient cell strain
CN113061605B (en) * 2020-07-13 2022-11-29 中山大学 Construction method and application of fucose transferase 8 (FUT 8) function-deficient cell strain

Also Published As

Publication number Publication date
AU2019283621B2 (en) 2023-03-30
CN112512310A (en) 2021-03-16
KR102170788B1 (en) 2020-10-28
EP3804512A1 (en) 2021-04-14
US12048296B2 (en) 2024-07-30
US20210127649A1 (en) 2021-05-06
AU2019283621A1 (en) 2021-01-21
JP2021526379A (en) 2021-10-07
KR20190139163A (en) 2019-12-17
EP3804512A4 (en) 2022-04-06
JP7268059B2 (en) 2023-05-02
CN112512310B (en) 2022-12-16

Similar Documents

Publication Publication Date Title
JP7350911B2 (en) Transgenic mice expressing human cereblon
CN113874496A (en) Humanized cell lines
EP0491057B1 (en) Hybridoma which produces avian specific immunoglobulin g
CN1033290A (en) Production of chimeric antibodies by homologous recombination
CA3106829A1 (en) Antigen-binding molecule containing two antigen-binding domains that are linked to each other
Gabaev et al. The human cytomegalovirus UL11 protein interacts with the receptor tyrosine phosphatase CD45, resulting in functional paralysis of T cells
WO2019235895A1 (en) Transgenic mouse for aglycosylated antibody production and use of aglycosylated antibody produced therefrom
CN106573973A (en) Production of fc fragments
Ilieva et al. Functionally active Fc mutant antibodies recognizing cancer antigens generated rapidly at high yields
WO2012053823A9 (en) Fusion protein having factor ix activity
WO2025037708A1 (en) Method for selection of cell line expressing high levels of recombinant protein using glutamine synthetase split expression vector
KR100951118B1 (en) A method for producing a vaccine against a cell surface expression vector of the F. C. domain of porcine immunoglobulin, a host cell transformed with the vector and a pig disease-related virus using the host cell
KR20230068415A (en) Mammalian cell lines with gene knockouts
US10421985B2 (en) Methods for producing sialylated therapeutic proteins
US20200157189A1 (en) Method for selecting polypeptide producing cells
WO2020166810A2 (en) Antibody fragment consisting only of constant regions of antibody and use thereof
WO2022154288A1 (en) Monoclonal antibody specifically binding to protein kinase a catalytic subunit alpha, and use thereof for cancer diagnosis
WO2018079997A1 (en) Aglycosylated antibody fc region for treating cancer
WO2010114270A2 (en) Method for selecting a high expression recombinant cell line
JP4742272B2 (en) Non-human animal in which the function of GsdmA gene is suppressed and the function of canceration-related gene is promoted or suppressed
WO2017082667A1 (en) Transgenic pig which simultaneously expresses ho-1 gene and tnfr1-fc gene, and comprises knocked-out ggta1 gene, and use thereof
WO2019151698A1 (en) Transgenic bird producing efficacy-improved human cd20-specific monoclonal antibody and preparation method therefor
WO2022211177A1 (en) Method for producing algae generating human immunoglobulin fc and target protein
WO2018233608A1 (en) NON-HUMAN ANIMAL GENETICALLY MODIFIED TO CD28 HUMAN OR CHIMERIC
CN121548585A (en) dsFv as an IgG fragment form and its generation and labeling methods

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19814996

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2020568257

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2019283621

Country of ref document: AU

Date of ref document: 20190607

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2019814996

Country of ref document: EP

Effective date: 20210111